ADAM metallopeptidase with thrombospondin type 1 motif, 2 (ADAMTS2) - coding DNA reference sequence

(used for mutation description)

(last modified October 11, 2012)


This file was created to facilitate the description of sequence variants in the ADAMTS2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_023212.2, covering ADAMTS2 transcript NM_014244.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.4940
                   agctgcgggcggctccagctgcccccagatgtgggctgggcg       c.-61

 .         .         .         .         .         .                g.5000
 gctcgcggggaactttcgcgccggctgcgagtgcggggccccggctgcagtccggctgcc       c.-1

          .         .         .         .         .         .       g.5060
 ATGGATCCGCCGGCGGGAGCCGCTCGCCGCCTGCTCTGCCCCGCGCTGCTGCTGCTGCTG       c.60
 M  D  P  P  A  G  A  A  R  R  L  L  C  P  A  L  L  L  L  L         p.20

          .         .         .         .         .         .       g.5120
 CTGCTGCTGCCGCCGCCGCTCCTGCCGCCGCCGCCGCCGCCCGCGAACGCCAGGCTCGCC       c.120
 L  L  L  P  P  P  L  L  P  P  P  P  P  P  A  N  A  R  L  A         p.40

          .          | 02        .         .         .         .    g.6208
 GCCGCCGCCGACCCCCCAG | GCGGGCCCCTGGGGCACGGAGCGGAGCGCATCCTGGCGGTG    c.180
 A  A  A  D  P  P  G |   G  P  L  G  H  G  A  E  R  I  L  A  V      p.60

          .         .         .         .         .         .       g.6268
 CCCGTGCGCACTGACGCCCAGGGCCGCTTGGTGTCCCACGTGGTGTCGGCAGCTACGTCC       c.240
 P  V  R  T  D  A  Q  G  R  L  V  S  H  V  V  S  A  A  T  S         p.80

          .         .         .         .         .         .       g.6328
 AGAGCAGGGGTACGAGCCCGCAGGGCCGCCCCGGTCCGGACCCCGAGCTTCCCCGGAGGC       c.300
 R  A  G  V  R  A  R  R  A  A  P  V  R  T  P  S  F  P  G  G         p.100

          .         .         .         .         .         .       g.6388
 AACGAGGAGGAGCCTGGCAGTCACCTCTTCTACAATGTCACGGTCTTTGGCCGAGACCTG       c.360
 N  E  E  E  P  G  S  H  L  F  Y  N  V  T  V  F  G  R  D  L         p.120

          .         .         .         .         .         .       g.6448
 CACCTGCGGCTGCGGCCCAACGCCCGCCTCGTGGCGCCCGGGGCCACTATGGAGTGGCAG       c.420
 H  L  R  L  R  P  N  A  R  L  V  A  P  G  A  T  M  E  W  Q         p.140

          .         .         .         .         .         .       g.6508
 GGCGAGAAGGGCACCACCCGCGTGGAGCCCCTGCTCGGGAGCTGTCTCTACGTCGGAGAC       c.480
 G  E  K  G  T  T  R  V  E  P  L  L  G  S  C  L  Y  V  G  D         p.160

          .         .         .         .         .     | 03   .    g.77270
 GTGGCCGGCCTAGCCGAAGCCTCCTCTGTGGCGCTCAGCAACTGCGATGGGCTG | GCTGGT    c.540
 V  A  G  L  A  E  A  S  S  V  A  L  S  N  C  D  G  L   | A  G      p.180

          .         .         .         .         .         .       g.77330
 CTGATCCGGATGGAGGAGGAGGAGTTCTTCATCGAACCCTTGGAGAAGGGGCTGGCGGCG       c.600
 L  I  R  M  E  E  E  E  F  F  I  E  P  L  E  K  G  L  A  A         p.200

          .         .         .         .         .         .       g.77390
 CAGGAGGCTGAGCAAGGCCGTGTGCATGTGGTGTATCGCCGGCCACCCACGTCCCCTCCT       c.660
 Q  E  A  E  Q  G  R  V  H  V  V  Y  R  R  P  P  T  S  P  P         p.220

          .         .         | 04         .         .         .    g.142645
 CTCGGGGGGCCACAGGCCCTGGACACAG | GGGCCTCCCTGGACAGCCTGGACAGCCTCAGC    c.720
 L  G  G  P  Q  A  L  D  T  G |   A  S  L  D  S  L  D  S  L  S      p.240

          .         .         .         .         .         .       g.142705
 CGCGCCCTGGGCGTCCTAGAGGAGCACGCCAACAGCTCGAGGCGGAGGGCACGCAGGCAT       c.780
 R  A  L  G  V  L  E  E  H  A  N  S  S  R  R  R  A  R  R  H         p.260

          .         .         .         .         .         .       g.142765
 GCTGCGGACGATGACTACAACATCGAGGTCCTGCTGGGCGTGGATGACTCTGTGGTGCAG       c.840
 A  A  D  D  D  Y  N  I  E  V  L  L  G  V  D  D  S  V  V  Q         p.280

          .         .         .         .         .  | 05      .    g.169182
 TTCCACGGGAAGGAGCACGTACAGAAGTACCTGCTGACACTCATGAACATT | GTCAATGAA    c.900
 F  H  G  K  E  H  V  Q  K  Y  L  L  T  L  M  N  I   | V  N  E      p.300

          .         .         .         .         .         .       g.169242
 ATCTACCATGACGAGTCCTTGGGTGCCCACATCAACGTGGTCCTGGTGCGGATCATCCTC       c.960
 I  Y  H  D  E  S  L  G  A  H  I  N  V  V  L  V  R  I  I  L         p.320

          .      | 06  .         .         .         .         .    g.191494
 CTGAGCTATGGAAAG | TCCATGAGCCTCATCGAGATCGGGAACCCCTCTCAGAGCCTGGAG    c.1020
 L  S  Y  G  K   | S  M  S  L  I  E  I  G  N  P  S  Q  S  L  E      p.340

          .         .         .         .         .         .       g.191554
 AATGTCTGCCGCTGGGCCTACCTCCAGCAGAAGCCAGACACGGGCCACGATGAATACCAC       c.1080
 N  V  C  R  W  A  Y  L  Q  Q  K  P  D  T  G  H  D  E  Y  H         p.360

          .         .         .         .         .   | 07     .    g.195417
 GATCACGCCATCTTCCTCACACGGCAGGACTTTGGGCCTTCCGGCATGCAAG | GCTATGCT    c.1140
 D  H  A  I  F  L  T  R  Q  D  F  G  P  S  G  M  Q  G |   Y  A      p.380

          .         .         .         .         .         .       g.195477
 CCTGTCACCGGCATGTGCCATCCGGTCCGCAGCTGCACCCTGAACCATGAGGACGGCTTC       c.1200
 P  V  T  G  M  C  H  P  V  R  S  C  T  L  N  H  E  D  G  F         p.400

          .         .         .         | 08         .         .    g.196158
 TCCTCAGCGTTTGTGGTGGCCCATGAGACTGGCCACGT | GCTGGGCATGGAGCACGACGGG    c.1260
 S  S  A  F  V  V  A  H  E  T  G  H  V  |  L  G  M  E  H  D  G      p.420

          .         .         .         .         .         .       g.196218
 CAGGGCAACCGCTGTGGCGACGAGGTGCGGCTGGGCAGCATCATGGCGCCCCTGGTGCAG       c.1320
 Q  G  N  R  C  G  D  E  V  R  L  G  S  I  M  A  P  L  V  Q         p.440

          .         .         .         .         .         .       g.196278
 GCCGCCTTCCACCGCTTCCACTGGTCCCGCTGCAGCCAGCAGGAGCTGAGCCGCTACCTG       c.1380
 A  A  F  H  R  F  H  W  S  R  C  S  Q  Q  E  L  S  R  Y  L         p.460

    | 09     .         .         .         .         .         .    g.196763
 CA | CTCCTATGACTGCCTGCTGGATGACCCCTTCGCCCACGACTGGCCGGCGCTGCCCCAG    c.1440
 H  |  S  Y  D  C  L  L  D  D  P  F  A  H  D  W  P  A  L  P  Q      p.480

          .         .         .         .         .         .       g.196823
 CTCCCGGGACTGCACTACTCCATGAACGAGCAATGCCGCTTTGACTTCGGCCTGGGCTAC       c.1500
 L  P  G  L  H  Y  S  M  N  E  Q  C  R  F  D  F  G  L  G  Y         p.500

          .      | 10  .         .         .         .         .    g.198118
 ATGATGTGCACGGCG | TTCCGGACCTTTGACCCCTGCAAGCAGCTGTGGTGCAGCCATCCT    c.1560
 M  M  C  T  A   | F  R  T  F  D  P  C  K  Q  L  W  C  S  H  P      p.520

          .         .         .         .         .         .       g.198178
 GACAACCCCTACTTTTGCAAGACCAAGAAGGGGCCCCCCTTGGACGGGACTATGTGTGCA       c.1620
 D  N  P  Y  F  C  K  T  K  K  G  P  P  L  D  G  T  M  C  A         p.540

           | 11        .         .         .         .         .    g.210344
 CCTGGCAAG | CATTGTTTTAAAGGACACTGCATCTGGCTGACACCTGACATCCTCAAACGG    c.1680
 P  G  K   | H  C  F  K  G  H  C  I  W  L  T  P  D  I  L  K  R      p.560

          .         .         .         .         .         .       g.210404
 GACGGCAGCTGGGGCGCTTGGAGTCCGTTTGGCTCCTGCTCACGTACCTGTGGCACGGGC       c.1740
 D  G  S  W  G  A  W  S  P  F  G  S  C  S  R  T  C  G  T  G         p.580

          .         .         .      | 12  .         .         .    g.212409
 GTGAAGTTCAGGACCCGCCAGTGTGACAACCCACA | CCCGGCCAACGGGGGCCGCACCTGC    c.1800
 V  K  F  R  T  R  Q  C  D  N  P  H  |  P  A  N  G  G  R  T  C      p.600

          .         .         .         .         .         .       g.212469
 TCGGGCCTTGCCTACGACTTCCAGCTCTGCAGCCGCCAGGACTGCCCCGACTCCCTGGCT       c.1860
 S  G  L  A  Y  D  F  Q  L  C  S  R  Q  D  C  P  D  S  L  A         p.620

          .         .         .         .         .         .       g.212529
 GACTTCCGCGAGGAGCAGTGCCGCCAGTGGGACCTGTACTTCGAGCACGGCGACGCCCAG       c.1920
 D  F  R  E  E  Q  C  R  Q  W  D  L  Y  F  E  H  G  D  A  Q         p.640

          .         .         .  | 13      .         .         .    g.214315
 CACCACTGGCTGCCCCACGAGCACCGGGATG | CCAAGGAGAGATGCCACCTGTACTGCGAG    c.1980
 H  H  W  L  P  H  E  H  R  D  A |   K  E  R  C  H  L  Y  C  E      p.660

          .         .         .         .         .         .       g.214375
 TCCAGGGAGACCGGGGAGGTGGTGTCCATGAAGCGCATGGTGCATGACGGGACGCGCTGC       c.2040
 S  R  E  T  G  E  V  V  S  M  K  R  M  V  H  D  G  T  R  C         p.680

          .         .         .         .      | 14  .         .    g.217443
 TCCTACAAGGACGCCTTCAGCCTCTGTGTGCGCGGGGACTGCAGG | AAGGTGGGCTGTGAC    c.2100
 S  Y  K  D  A  F  S  L  C  V  R  G  D  C  R   | K  V  G  C  D      p.700

          .         .         .         .         .         .       g.217503
 GGTGTGATCGGCTCCAGCAAGCAGGAAGACAAGTGTGGCGTGTGCGGAGGGGACAACAGC       c.2160
 G  V  I  G  S  S  K  Q  E  D  K  C  G  V  C  G  G  D  N  S         p.720

          .         .         .         .          | 15        .    g.218029
 CACTGCAAAGTGGTCAAGGGCACGTTCACACGGTCACCCAAGAAGCATG | GTTACATCAAG    c.2220
 H  C  K  V  V  K  G  T  F  T  R  S  P  K  K  H  G |   Y  I  K      p.740

          .         .         .         .         .         .       g.218089
 ATGTTTGAGATCCCTGCAGGAGCCAGACACCTGCTCATTCAGGAGGTAGACGCCACCAGC       c.2280
 M  F  E  I  P  A  G  A  R  H  L  L  I  Q  E  V  D  A  T  S         p.760

          . | 16       .         .         .         .         .    g.220280
 CACCATCTGG | CCGTCAAGAACCTGGAGACAGGCAAGTTCATCTTAAATGAAGAGAATGAC    c.2340
 H  H  L  A |   V  K  N  L  E  T  G  K  F  I  L  N  E  E  N  D      p.780

          .         .         .         .         .         .       g.220340
 GTGGATGCCAGTTCCAAAACCTTCATTGCCATGGGCGTGGAGTGGGAGTACAGAGACGAG       c.2400
 V  D  A  S  S  K  T  F  I  A  M  G  V  E  W  E  Y  R  D  E         p.800

          .         .         .         .         .        | 17.    g.222213
 GACGGCCGGGAGACGCTGCAGACCATGGGCCCCCTCCACGGCACCATCACCGTTCTG | GTC    c.2460
 D  G  R  E  T  L  Q  T  M  G  P  L  H  G  T  I  T  V  L   | V      p.820

          .         .         .         .         .         .       g.222273
 ATCCCGGTGGGAGACACCCGGGTCTCACTGACGTACAAATACATGATCCATGAGGACTCA       c.2520
 I  P  V  G  D  T  R  V  S  L  T  Y  K  Y  M  I  H  E  D  S         p.840

          .         .         .         .         .         .       g.222333
 CTGAATGTCGACGACAACAACGTCCTGGAAGAGGACTCTGTGGTCTACGAGTGGGCCCTG       c.2580
 L  N  V  D  D  N  N  V  L  E  E  D  S  V  V  Y  E  W  A  L         p.860

          .         .         .        | 18.         .         .    g.224221
 AAGAAGTGGTCTCCGTGCTCCAAGCCCTGTGGCGGAG | GGTCCCAGTTCACCAAGTATGGC    c.2640
 K  K  W  S  P  C  S  K  P  C  G  G  G |   S  Q  F  T  K  Y  G      p.880

          .         .         .         .         .         .       g.224281
 TGCCGCCGGAGGCTGGACCACAAGATGGTACACCGTGGCTTCTGTGCCGCCCTCTCGAAG       c.2700
 C  R  R  R  L  D  H  K  M  V  H  R  G  F  C  A  A  L  S  K         p.900

          .         .         .         .         . | 19       .    g.225158
 CCCAAAGCCATCCGCAGAGCGTGCAACCCACAGGAATGCTCCCAGCCAGT | GTGGGTCACA    c.2760
 P  K  A  I  R  R  A  C  N  P  Q  E  C  S  Q  P  V  |  W  V  T      p.920

          .         .         .         .         .         .       g.225218
 GGCGAATGGGAGCCATGTAGCCAGACCTGTGGGCGGACAGGCATGCAGGTGCGCTCCGTG       c.2820
 G  E  W  E  P  C  S  Q  T  C  G  R  T  G  M  Q  V  R  S  V         p.940

          .         .         .         .         .         .       g.225278
 CGCTGCATTCAGCCGCTACACGACAACACCACCCGCTCCGTGCACGCCAAGCACTGCAAT       c.2880
 R  C  I  Q  P  L  H  D  N  T  T  R  S  V  H  A  K  H  C  N         p.960

          .         .         .         .         .         .       g.225338
 GACGCCCGGCCCGAGAGCCGCCGGGCCTGCAGCCGCGAGCTCTGCCCTGGTCGTTGGCGA       c.2940
 D  A  R  P  E  S  R  R  A  C  S  R  E  L  C  P  G  R  W  R         p.980

          .         | 20         .         .         .         .    g.227597
 GCCGGGCCCTGGTCCCAG | TGCTCAGTAACCTGTGGCAACGGCACCCAGGAGCGGCCAGTG    c.3000
 A  G  P  W  S  Q   | C  S  V  T  C  G  N  G  T  Q  E  R  P  V      p.1000

          .         .         .         .         .         .       g.227657
 CTCTGCCGCACCGCGGACGACAGCTTCGGCATCTGCCAGGAGGAGCGTCCTGAGACAGCG       c.3060
 L  C  R  T  A  D  D  S  F  G  I  C  Q  E  E  R  P  E  T  A         p.1020

          .         .         | 21         .         .         .    g.228610
 AGGACCTGCAGGCTTGGCCCCTGTCCCC | GAAACATCTCAGATCCCTCCAAGAAGAGCTAC    c.3120
 R  T  C  R  L  G  P  C  P  R |   N  I  S  D  P  S  K  K  S  Y      p.1040

          .         .         .         .         .         | 22    g.236006
 GTAGTTCAGTGGCTGTCCCGCCCGGACCCCGACTCGCCCATCCGGAAGATCTCGTCAA | AG    c.3180
 V  V  Q  W  L  S  R  P  D  P  D  S  P  I  R  K  I  S  S  K |       p.1060

          .         .         .         .         .         .       g.236066
 GGCCACTGCCAAGGCGACAAGTCAATATTCTGTAGGATGGAAGTCTTGTCCCGCTATTGC       c.3240
 G  H  C  Q  G  D  K  S  I  F  C  R  M  E  V  L  S  R  Y  C         p.1080

          .         .         .         .         .         .       g.236126
 TCCATCCCAGGCTACAACAAGCTGTGCTGCAAGTCCTGTAACCTGTACAACAACCTCACC       c.3300
 S  I  P  G  Y  N  K  L  C  C  K  S  C  N  L  Y  N  N  L  T         p.1100

          .         .         .         .         .         .       g.236186
 AACGTGGAGGGCAGGATAGAGCCACCGCCTGGGAAGCACAACGACATTGACGTGTTCATG       c.3360
 N  V  E  G  R  I  E  P  P  P  G  K  H  N  D  I  D  V  F  M         p.1120

          .         .         .         .         .         .       g.236246
 CCTACCCTCCCAGTGCCCACTGTAGCCATGGAGGTGCGGCCATCACCAAGCACCCCCCTG       c.3420
 P  T  L  P  V  P  T  V  A  M  E  V  R  P  S  P  S  T  P  L         p.1140

          .         .         .         .         .         .       g.236306
 GAGGTCCCTCTCAATGCCTCCAGCACCAATGCCACAGAGGATCACCCAGAAACCAATGCC       c.3480
 E  V  P  L  N  A  S  S  T  N  A  T  E  D  H  P  E  T  N  A         p.1160

          .         .         .         .         .         .       g.236366
 GTAGATGAACCCTACAAAATCCATGGCCTGGAAGATGAAGTCCAGCCACCCAACCTAATC       c.3540
 V  D  E  P  Y  K  I  H  G  L  E  D  E  V  Q  P  P  N  L  I         p.1180

          .         .         .         .         .         .       g.236426
 CCTCGACGACCGAGCCCCTATGAAAAGACCAGAAACCAAAGAATCCAAGAGCTCATTGAT       c.3600
 P  R  R  P  S  P  Y  E  K  T  R  N  Q  R  I  Q  E  L  I  D         p.1200

          .         .         .                                     g.236462
 GAGATGCGGAAGAAAGAGATGCTCGGAAAGTTCTAA                               c.3636
 E  M  R  K  K  E  M  L  G  K  F  X                                 p.1211

          .         .         .         .         .         .       g.236522
 taaaatggaaagatagcatccctagcatttttttcttgcttatagagatattccatggga       c.*60

          .         .         .         .         .         .       g.236582
 tagcaaatcctgtgtcatggagatgaagtcaaaattcctgattccaaaaggttttgagaa       c.*120

          .         .         .         .         .         .       g.236642
 aacaaagagggggaatgacgtaagaaagataggcatgagcatgtggtaactaggttagca       c.*180

          .         .         .         .         .         .       g.236702
 cgtgtgcttcccagcccaggagcgaccaaatactgtggtggcgtcaggtgtgcagtggag       c.*240

          .         .         .         .         .         .       g.236762
 aggaatatagaggctgtatggcctccctcagtgagggcagggcaagagggatcactctga       c.*300

          .         .         .         .         .         .       g.236822
 gagaacaaaaataggccccaagttgctaagcagtgattgggaaccttcctttccttggcg       c.*360

          .         .         .         .         .         .       g.236882
 gagatgcatgacattccctaccgatccccagacacagcctgtgggactcttaggagaaat       c.*420

          .         .         .         .         .         .       g.236942
 ggtgatttactgaataactgacccgttgccgagatgagtacaatgaagtggaggtgatga       c.*480

          .         .         .         .         .         .       g.237002
 actcaaatcgtcttccagggccaggcggctgaccggggtgagcgtagtggcccgctgggg       c.*540

          .         .         .         .         .         .       g.237062
 accatggccgccctgacagccacacccacctggagctgacttggttctggctgttgctgc       c.*600

          .         .         .         .         .         .       g.237122
 cactgtgaaatctgtatctctctccatctctgctctactatccccggccttgccagacag       c.*660

          .         .         .         .         .         .       g.237182
 tgttctttttcggaagaagtctagatttttgcatgaaaaaaactcaatctttaaaggtcg       c.*720

          .         .         .         .         .         .       g.237242
 actcagaacattttaaggaggcctccacttggtctgatgcagtcttgctaattaagaact       c.*780

          .         .         .         .         .         .       g.237302
 aaaggccttctgaccttcttggtgctcatgctgtacggcatctgaatgtctcgaccgagt       c.*840

          .         .         .         .         .         .       g.237362
 ctgagccgtgcagctgtcctccacctgcgaaagtaatgagaatcctatcacgggacataa       c.*900

          .         .         .         .         .         .       g.237422
 ggataggtctaaacagggtccatgccaagaaaacagtggggtgctctcccaggcctctcc       c.*960

          .         .         .         .         .         .       g.237482
 cctgtccactaaccctggccttgccggctgccttccaggctctgggggaagagctcctgc       c.*1020

          .         .         .         .         .         .       g.237542
 attcttccctggccaccttggctccagggctccccagagagcctcttccctccccaagta       c.*1080

          .         .         .         .         .         .       g.237602
 cctgagaaagatgagagaggcacgtgctctgctgggaaggtccagtgagcggttcaaggg       c.*1140

          .         .         .         .         .         .       g.237662
 cctggaatctccctacggccaagtctaagggttctgggattctgggctttgtgggctttg       c.*1200

          .         .         .         .         .         .       g.237722
 cttgcttgctgggaatgggctttccctgtcccgccctgccccacctcgcctctgtctctc       c.*1260

          .         .         .         .         .         .       g.237782
 agaagctccagaacccagcagtgacctgcaaaatgtggcctctgatgggggcttagggtg       c.*1320

          .         .         .         .         .         .       g.237842
 ggagatggggagagcctacattgtcttttgctccttgaaaactttaatagctcctatttt       c.*1380

          .         .         .         .         .         .       g.237902
 ccagagaatggtgctttgtgagcaacatgcgagtaagagagaaataggaggaagggggag       c.*1440

          .         .         .         .         .         .       g.237962
 taggggcggatgggagaagagtggctcatttttacctctcactgccttgacattttgtga       c.*1500

          .         .         .         .         .         .       g.238022
 acgtgaagcttaaactttctgggcttacaagacccaggggcacgtcagctccttagatgg       c.*1560

          .         .         .         .         .         .       g.238082
 gctcagcctgacacataattcttaaacctttcctgtttaagaaacttctagaggctgtgt       c.*1620

          .         .         .         .         .         .       g.238142
 actctcaccaatcctcttcgagaatttgttcatgtgtatttccccattatatggatgagg       c.*1680

          .         .         .         .         .         .       g.238202
 ctcaggataacagcatagtggctaccttctactgagttttgaggtgctaataagtatgtt       c.*1740

          .         .         .         .         .         .       g.238262
 tgtctgaggctgcacatgtgggtggctctgtgtgtatgatccaagggacaaaatgacgat       c.*1800

          .         .         .         .         .         .       g.238322
 gtaggaaccagcaagaacggaatctgggctgatgcttcagtctccacctgggtgatggct       c.*1860

          .         .         .         .         .         .       g.238382
 agcctcccgccctccaccaccgcatcccacacgtgctgcgcactgtccccgtgtctcctg       c.*1920

          .         .         .         .         .         .       g.238442
 gagaaccaaactggagaaaacctttctgagtatctctcatagtaccccttccttaagaag       c.*1980

          .         .         .         .         .         .       g.238502
 atgtggtttagagcatgtgtgcaatcctgcctctgtaattaggaaacggagcccgaggct       c.*2040

          .         .         .         .         .         .       g.238562
 ttccattgttggttgaacccaggacagctggtgctattcacaggctgaagaactgggcag       c.*2100

          .         .         .         .         .         .       g.238622
 ttcttacttgggtctgtcctaggatgtggaggaagttcaggactaacgctaggcagagag       c.*2160

          .         .         .         .         .         .       g.238682
 tatgactcggtttacccagcctaggggcctctggatgggaacactccattccaagatctc       c.*2220

          .         .         .         .         .         .       g.238742
 agcagagcagggcttcctggcttgaggctggaagcctttgggaagaggcccagctgggac       c.*2280

          .         .         .         .         .         .       g.238802
 attccctgggcacctgtcttccgctgaagggagcaaggtgccctctgggactgacagcca       c.*2340

          .         .         .         .         .         .       g.238862
 tgaccctctgtgccatcctcaatccttgagccatatatcaagagtcctctagagccggat       c.*2400

          .         .         .         .         .         .       g.238922
 ggtcctcaaaagtctgtccaaggaatgccaacgttcaccgggctctgagaaacgacgcaa       c.*2460

          .         .         .         .         .         .       g.238982
 atctctgagctggggaccacttggagaaccggcttagtaacagtcctgatcttcgcaagc       c.*2520

          .         .         .         .         .         .       g.239042
 cagcttcttctgcatctgaggggctcctggcgcccagaggaggcagacagatgtcttcta       c.*2580

          .         .         .         .         .         .       g.239102
 gctgagtttctaaccgcatgatgagactcagaccttccgctgcactagaaaatctgcaac       c.*2640

          .         .         .         .         .         .       g.239162
 agtgtccctgagtcacttctccttagtgggcagactcgtgttagatttgtggaacccagc       c.*2700

          .         .         .         .         .         .       g.239222
 tctctgatttactccttttggaaaacccatggaatttcatgtataaggctttcatttgta       c.*2760

          .         .         .         .         .         .       g.239282
 ttttaaggtttttctgtttgttttgagtatatacatggtgctcaatagcaacatcttagc       c.*2820

          .         .         .         .         .         .       g.239342
 agatgaagcagtttatgattccactccctcctgtatgacaggtagccactatactgaatc       c.*2880

          .         .         .         .         .         .       g.239402
 aaggtgctgaactcaaatcacaaaattctggcttaccgatacaacaaccaatacatcttt       c.*2940

          .         .         .         .         .         .       g.239462
 gttctgtaatgtaaaatttgactccttacttttataacttattaaagttaaaatgtctgt       c.*3000

          .                                                         g.239478
 gtttttgcaaatcatg                                                   c.*3016

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ADAM metallopeptidase with thrombospondin type 1 motif, 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center