AE binding protein 1 (AEBP1) - coding DNA reference sequence

(used for mutation description)

(last modified April 26, 2018)


This file was created to facilitate the description of sequence variants in the AEBP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from VERSION NG_056775.1, covering AEBP1 transcript NM_001129.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5046
                                                        cggct       c.-301

 .         .         .         .         .         .                g.5106
 atccgcgcgggagtgcgccacgcggggccggagcgcctattagccgccaggacctcggag       c.-241

 .         .         .         .         .         .                g.5166
 cgccccgaccacccctgagcccctctggcttcggagccccccagcaccccttcccgggtc       c.-181

 .         .         .         .         .         .                g.5226
 ccctcgcccaccctaatccactctccctccctttcccggattccctcgctcaccccatcc       c.-121

 .         .         .         .         .         .                g.5286
 tctctcccgccccttcctggattccctcacccgtctcgatcccctctccgccctttccca       c.-61

 .         .         .         .         .         .                g.5346
 gagacccagagcccctgaccccccgcgccctccccggagccccccgcgcgtgccgcggcc       c.-1

          .         .         .         .         .         .       g.5406
 ATGGCGGCCGTGCGCGGGGCGCCCCTGCTCAGCTGCCTCCTGGCGTTGCTGGCCCTGTGC       c.60
 M  A  A  V  R  G  A  P  L  L  S  C  L  L  A  L  L  A  L  C         p.20

          .         .         .         .         .         .       g.5466
 CCTGGAGGGCGCCCGCAGACGGTGCTGACCGACGACGAGATCGAGGAGTTCCTCGAGGGC       c.120
 P  G  G  R  P  Q  T  V  L  T  D  D  E  I  E  E  F  L  E  G         p.40

          .         .         .         .         .         .       g.5526
 TTCCTGTCAGAGCTAGAACCTGAGCCCCGGGAGGACGACGTGGAGGCCCCGCCGCCTCCC       c.180
 F  L  S  E  L  E  P  E  P  R  E  D  D  V  E  A  P  P  P  P         p.60

          .         .         .         .         .         .       g.5586
 GAGCCCACCCCGCGGGTCCGAAAAGCCCAGGCGGGGGGCAAGCCAGGGAAGCGGCCAGGG       c.240
 E  P  T  P  R  V  R  K  A  Q  A  G  G  K  P  G  K  R  P  G         p.80

          .    | 02    .         .         .         .         .    g.7273
 ACGGCCGCAGAAG | TGCCTCCGGAAAAGACCAAAGACAAAGGGAAGAAAGGCAAGAAAGAC    c.300
 T  A  A  E  V |   P  P  E  K  T  K  D  K  G  K  K  G  K  K  D      p.100

          .         .         .         .         .         .       g.7333
 AAAGGCCCCAAGGTGCCCAAGGAGTCCTTGGAGGGGTCCCCCAGGCCGCCCAAGAAGGGG       c.360
 K  G  P  K  V  P  K  E  S  L  E  G  S  P  R  P  P  K  K  G         p.120

          .         .         .         .         .         .       g.7393
 AAGGAGAAGCCACCCAAGGCCACCAAGAAGCCCAAGGAGAAGCCACCTAAGGCCACCAAG       c.420
 K  E  K  P  P  K  A  T  K  K  P  K  E  K  P  P  K  A  T  K         p.140

          .         .         .         .         .         .       g.7453
 AAGCCCAAGGAGAAGCCACCCAAGGCCACCAAGAAGCCCAAAGAGAAGCCACCCAAGGCC       c.480
 K  P  K  E  K  P  P  K  A  T  K  K  P  K  E  K  P  P  K  A         p.160

          .         .         .         .         .         .       g.7513
 ACCAAGAAGCCCCCGTCAGGGAAGAGGCCCCCCATTCTGGCTCCCTCAGAAACCCTGGAG       c.540
 T  K  K  P  P  S  G  K  R  P  P  I  L  A  P  S  E  T  L  E         p.180

          .         .         .         .         .      | 03  .    g.8124
 TGGCCACTGCCCCCACCCCCCAGCCCTGGCCCCGAGGAGCTACCCCAGGAGGGAG | GGGCG    c.600
 W  P  L  P  P  P  P  S  P  G  P  E  E  L  P  Q  E  G  G |   A      p.200

          .         .         .         .         .         .       g.8184
 CCCCTCTCAAATAACTGGCAGAATCCAGGAGAGGAGACCCATGTGGAGGCACGGGAGCAC       c.660
 P  L  S  N  N  W  Q  N  P  G  E  E  T  H  V  E  A  R  E  H         p.220

         | 04.         .         .         .         .         .    g.8362
 CAGCCTG | AGCCGGAGGAGGAGACCGAGCAACCCACACTGGACTACAATGACCAGATCGAG    c.720
 Q  P  E |   P  E  E  E  T  E  Q  P  T  L  D  Y  N  D  Q  I  E      p.240

          .          | 05        .         .         .         .    g.8530
 AGGGAGGACTATGAGGACT | TTGAGTACATTCGGCGCCAGAAGCAACCCAGGCCACCCCCA    c.780
 R  E  D  Y  E  D  F |   E  Y  I  R  R  Q  K  Q  P  R  P  P  P      p.260

          .         .         .         .         .         .       g.8590
 AGCAGAAGGAGGAGGCCCGAGCGGGTCTGGCCAGAGCCCCCTGAGGAGAAGGCCCCGGCC       c.840
 S  R  R  R  R  P  E  R  V  W  P  E  P  P  E  E  K  A  P  A         p.280

          .         .   | 06     .         .         .         .    g.8725
 CCAGCCCCGGAGGAGAGGATTG | AGCCTCCTGTGAAGCCTCTGCTGCCCCCGCTGCCCCCT    c.900
 P  A  P  E  E  R  I  E |   P  P  V  K  P  L  L  P  P  L  P  P      p.300

          .         .         .         . | 07       .         .    g.9599
 GACTATGGTGATGGTTACGTGATCCCCAACTACGATGACA | TGGACTATTACTTTGGGCCT    c.960
 D  Y  G  D  G  Y  V  I  P  N  Y  D  D  M |   D  Y  Y  F  G  P      p.320

          .         .         .         .         .         | 08    g.9789
 CCTCCGCCCCAGAAGCCCGATGCTGAGCGCCAGACAGACGAAGAGAAGGAGGAGCTGA | AG    c.1020
 P  P  P  Q  K  P  D  A  E  R  Q  T  D  E  E  K  E  E  L  K |       p.340

          .         .         .         .         .         .       g.9849
 AAACCCAAAAAGGAGGACAGCAGCCCCAAGGAGGAGACCGACAAGTGGGCAGTGGAGAAG       c.1080
 K  P  K  K  E  D  S  S  P  K  E  E  T  D  K  W  A  V  E  K         p.360

          .       | 09 .         .         .         .         .    g.10012
 GGCAAGGACCACAAAG | AGCCCCGAAAGGGCGAGGAGTTGGAGGAGGAGTGGACGCCTACG    c.1140
 G  K  D  H  K  E |   P  R  K  G  E  E  L  E  E  E  W  T  P  T      p.380

          . | 10       .         .         .         .         .    g.10745
 GAGAAAGTCA | AGTGTCCCCCCATTGGGATGGAGTCACACCGTATTGAGGACAACCAGATC    c.1200
 E  K  V  K |   C  P  P  I  G  M  E  S  H  R  I  E  D  N  Q  I      p.400

          .         .         .         .         .         .       g.10805
 CGAGCCTCCTCCATGCTGCGCCACGGCCTGGGGGCACAGCGCGGCCGGCTCAACATGCAG       c.1260
 R  A  S  S  M  L  R  H  G  L  G  A  Q  R  G  R  L  N  M  Q         p.420

  | 11       .         .         .         .         .         .    g.10947
  | ACCGGTGCCACTGAGGACGACTACTATGATGGTGCGTGGTGTGCCGAGGACGATGCCAGG    c.1320
  | T  G  A  T  E  D  D  Y  Y  D  G  A  W  C  A  E  D  D  A  R      p.440

          .         .         .         .         .         .       g.11007
 ACCCAGTGGATAGAGGTGGACACCAGGAGGACTACCCGGTTCACAGGCGTCATCACCCAG       c.1380
 T  Q  W  I  E  V  D  T  R  R  T  T  R  F  T  G  V  I  T  Q         p.460

          .         . | 12       .         .         .         .    g.11445
 GGCAGAGACTCCAGCATCCA | TGACGATTTTGTGACCACCTTCTTCGTGGGCTTCAGCAAT    c.1440
 G  R  D  S  S  I  H  |  D  D  F  V  T  T  F  F  V  G  F  S  N      p.480

          .         .         .         .      | 13  .         .    g.11608
 GACAGCCAGACATGGGTGATGTACACCAACGGCTATGAGGAAATG | ACCTTTCATGGGAAC    c.1500
 D  S  Q  T  W  V  M  Y  T  N  G  Y  E  E  M   | T  F  H  G  N      p.500

          .         .         .         .         .         .       g.11668
 GTGGACAAGGACACACCCGTGCTGAGTGAGCTCCCAGAGCCGGTGGTGGCTCGTTTCATC       c.1560
 V  D  K  D  T  P  V  L  S  E  L  P  E  P  V  V  A  R  F  I         p.520

          .         .         .         .         .         .       g.11728
 CGCATCTACCCACTCACCTGGAATGGCAGCCTGTGCATGCGCCTGGAGGTGCTGGGGTGC       c.1620
 R  I  Y  P  L  T  W  N  G  S  L  C  M  R  L  E  V  L  G  C         p.540

          . | 14       .         .         .         .         .    g.11884
 TCTGTGGCCC | CTGTCTACAGCTACTACGCACAGAATGAGGTGGTGGCCACCGATGACCTG    c.1680
 S  V  A  P |   V  Y  S  Y  Y  A  Q  N  E  V  V  A  T  D  D  L      p.560

          .         .         .       | 15 .         .         .    g.12211
 GATTTCCGGCACCACAGCTACAAGGACATGCGCCAG | CTCATGAAGGTGGTGAACGAGGAG    c.1740
 D  F  R  H  H  S  Y  K  D  M  R  Q   | L  M  K  V  V  N  E  E      p.580

          .         .         .         .         .         .       g.12271
 TGCCCCACCATCACCCGCACTTACAGCCTGGGCAAGAGCTCACGAGGCCTCAAGATCTAT       c.1800
 C  P  T  I  T  R  T  Y  S  L  G  K  S  S  R  G  L  K  I  Y         p.600

          .         .         .         . | 16       .         .    g.12554
 GCCATGGAGATCTCAGACAACCCTGGGGAGCATGAACTGG | GGGAGCCCGAGTTCCGCTAC    c.1860
 A  M  E  I  S  D  N  P  G  E  H  E  L  G |   E  P  E  F  R  Y      p.620

          .         .         .         .         .         .       g.12614
 ACTGCTGGGATCCATGGCAACGAGGTGCTGGGCCGAGAGCTGTTGCTGCTGCTCATGCAG       c.1920
 T  A  G  I  H  G  N  E  V  L  G  R  E  L  L  L  L  L  M  Q         p.640

          .         .         .         .         .         .       g.12674
 TACCTGTGCCGAGAGTACCGCGATGGGAACCCACGTGTGCGCAGCCTGGTGCAGGACACA       c.1980
 Y  L  C  R  E  Y  R  D  G  N  P  R  V  R  S  L  V  Q  D  T         p.660

          .         .         .         .         .        | 17.    g.12825
 CGCATCCACCTGGTGCCCTCACTGAACCCTGATGGCTACGAGGTGGCAGCGCAGATG | GGC    c.2040
 R  I  H  L  V  P  S  L  N  P  D  G  Y  E  V  A  A  Q  M   | G      p.680

          .         .         .         .         .         .       g.12885
 TCAGAGTTTGGGAACTGGGCGCTGGGACTGTGGACTGAGGAGGGCTTTGACATCTTTGAA       c.2100
 S  E  F  G  N  W  A  L  G  L  W  T  E  E  G  F  D  I  F  E         p.700

          .         .         .         .         .         .       g.12945
 GATTTCCCGGATCTCAACTCTGTGCTCTGGGGAGCTGAGGAGAGGAAATGGGTCCCCTAC       c.2160
 D  F  P  D  L  N  S  V  L  W  G  A  E  E  R  K  W  V  P  Y         p.720

          .         .         .         .         .        | 18.    g.13241
 CGGGTCCCCAACAATAACTTGCCCATCCCTGAACGCTACCTTTCGCCAGATGCCACG | GTA    c.2220
 R  V  P  N  N  N  L  P  I  P  E  R  Y  L  S  P  D  A  T   | V      p.740

          .         .         .         .         .         .       g.13301
 TCCACGGAGGTCCGGGCCATCATTGCCTGGATGGAGAAGAACCCCTTCGTGCTGGGAGCA       c.2280
 S  T  E  V  R  A  I  I  A  W  M  E  K  N  P  F  V  L  G  A         p.760

          .         .         .         .         .         .       g.13361
 AATCTGAACGGCGGCGAGCGGCTAGTATCCTACCCCTACGATATGGCCCGCACGCCTACC       c.2340
 N  L  N  G  G  E  R  L  V  S  Y  P  Y  D  M  A  R  T  P  T         p.780

          .         .         .         .         .         .       g.13421
 CAGGAGCAGCTGCTGGCCGCAGCCATGGCAGCAGCCCGGGGGGAGGATGAGGACGAGGTC       c.2400
 Q  E  Q  L  L  A  A  A  M  A  A  A  R  G  E  D  E  D  E  V         p.800

          .         .         .         .         .         .       g.13481
 TCCGAGGCCCAGGAGACTCCAGACCACGCCATCTTCCGGTGGCTTGCCATCTCCTTCGCC       c.2460
 S  E  A  Q  E  T  P  D  H  A  I  F  R  W  L  A  I  S  F  A         p.820

          .         .         .         .         .         .       g.13541
 TCCGCACACCTCACCTTGACCGAGCCCTACCGCGGAGGCTGCCAAGCCCAGGACTACACC       c.2520
 S  A  H  L  T  L  T  E  P  Y  R  G  G  C  Q  A  Q  D  Y  T         p.840

          .         .         .         .          | 19        .    g.13682
 GGCGGCATGGGCATCGTCAACGGGGCCAAGTGGAACCCCCGGACCGGGA | CTATCAATGAC    c.2580
 G  G  M  G  I  V  N  G  A  K  W  N  P  R  T  G  T |   I  N  D      p.860

          .         .         .         .         .         .       g.13742
 TTCAGTTACCTGCATACCAACTGCCTGGAGCTCTCCTTCTACCTGGGCTGTGACAAGTTC       c.2640
 F  S  Y  L  H  T  N  C  L  E  L  S  F  Y  L  G  C  D  K  F         p.880

          .         .         .         .         .         .       g.13802
 CCTCATGAGAGTGAGCTGCCCCGCGAGTGGGAGAACAACAAGGAGGCGCTGCTCACCTTC       c.2700
 P  H  E  S  E  L  P  R  E  W  E  N  N  K  E  A  L  L  T  F         p.900

           | 20        .         .         .         .         .    g.13983
 ATGGAGCAG | GTGCACCGCGGCATTAAGGGGGTGGTGACGGACGAGCAAGGCATCCCCATT    c.2760
 M  E  Q   | V  H  R  G  I  K  G  V  V  T  D  E  Q  G  I  P  I      p.920

          .         .         .         .          | 21        .    g.14285
 GCCAACGCCACCATCTCTGTGAGTGGCATTAATCACGGCGTGAAGACAG | CCAGTGGTGGT    c.2820
 A  N  A  T  I  S  V  S  G  I  N  H  G  V  K  T  A |   S  G  G      p.940

          .         .         .         .         .         .       g.14345
 GATTACTGGCGAATCTTGAACCCGGGTGAGTACCGCGTGACAGCCCACGCGGAGGGCTAC       c.2880
 D  Y  W  R  I  L  N  P  G  E  Y  R  V  T  A  H  A  E  G  Y         p.960

          .         .         .         .         .         .       g.14405
 ACCCCGAGCGCCAAGACCTGCAATGTTGACTATGACATCGGGGCCACTCAGTGCAACTTC       c.2940
 T  P  S  A  K  T  C  N  V  D  Y  D  I  G  A  T  Q  C  N  F         p.980

          .         .         .         .         .         .       g.14465
 ATCCTGGCTCGCTCCAACTGGAAGCGCATCCGGGAGATCATGGCCATGAACGGGAACCGG       c.3000
 I  L  A  R  S  N  W  K  R  I  R  E  I  M  A  M  N  G  N  R         p.1000

          .         .         .         .         .         .       g.14525
 CCTATCCCACACATAGACCCATCGCGCCCTATGACCCCCCAACAGCGACGCCTGCAGCAG       c.3060
 P  I  P  H  I  D  P  S  R  P  M  T  P  Q  Q  R  R  L  Q  Q         p.1020

          .         .         .         .         .         .       g.14585
 CGACGCCTACAACACCGCCTGCGGCTTCGGGCACAGATGCGGCTGCGGCGCCTCAACGCC       c.3120
 R  R  L  Q  H  R  L  R  L  R  A  Q  M  R  L  R  R  L  N  A         p.1040

          .         .         .         .         .         .       g.14645
 ACCACCACCCTAGGCCCCCACACTGTGCCTCCCACGCTGCCCCCTGCCCCTGCCACCACC       c.3180
 T  T  T  L  G  P  H  T  V  P  P  T  L  P  P  A  P  A  T  T         p.1060

          .         .         .         .         .         .       g.14705
 CTGAGCACTACCATAGAGCCCTGGGGCCTCATACCGCCAACCACCGCTGGCTGGGAGGAG       c.3240
 L  S  T  T  I  E  P  W  G  L  I  P  P  T  T  A  G  W  E  E         p.1080

          .         .         .         .         .         .       g.14765
 TCGGAGACTGAGACCTACACAGAGGTGGTGACAGAGTTTGGGACCGAGGTGGAGCCCGAG       c.3300
 S  E  T  E  T  Y  T  E  V  V  T  E  F  G  T  E  V  E  P  E         p.1100

          .         .         .         .         .         .       g.14825
 TTTGGGACCAAGGTGGAGCCCGAGTTTGAGACCCAGTTGGAGCCTGAGTTTGAGACCCAG       c.3360
 F  G  T  K  V  E  P  E  F  E  T  Q  L  E  P  E  F  E  T  Q         p.1120

          .         .         .         .         .         .       g.14885
 CTGGAACCCGAGTTTGAGGAAGAGGAGGAGGAGGAGAAAGAGGAGGAGATAGCCACTGGC       c.3420
 L  E  P  E  F  E  E  E  E  E  E  E  K  E  E  E  I  A  T  G         p.1140

          .         .         .         .         .                 g.14942
 CAGGCATTCCCCTTCACAACAGTAGAGACCTACACAGTGAACTTTGGGGACTTCTGA          c.3477
 Q  A  F  P  F  T  T  V  E  T  Y  T  V  N  F  G  D  F  X            p.1158

          .         .         .         .         .         .       g.15002
 gatcagcgtcctaccaagaccccagcccaactcaagctacagcagcagcacttcccaagc       c.*60

          .         .         .         .         .         .       g.15062
 ctgctgaccacagtcacatcacccatcagcacatggaaggcccctggtatggacactgaa       c.*120

          .         .         .         .         .         .       g.15122
 aggaagggctggtcctgcccctttgagggggtgcaaacatgactgggacctaagagccag       c.*180

          .         .         .         .         .         .       g.15182
 aggctgtgtagaggctcctgctccacctgccagtctcgtaagagatggggttgctgcagt       c.*240

          .         .         .         .         .         .       g.15242
 gttggagtaggggcagagggagggagccaaggtcactccaataaaacaagctcatggcac       c.*300

                                                                    g.15246
 ggac                                                               c.*304

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The AE binding protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 36
©2004-2018 Leiden University Medical Center