xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (B4GALT7) - coding DNA reference sequence

(used for mutation description)

(last modified November 20, 2013)


This file was created to facilitate the description of sequence variants in the B4GALT7 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_015977.1, covering B4GALT7 transcript NM_007255.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5033
                            gcggagcgggaggcggaggcgccgcgtaggccc       c.-61

 .         .         .         .         .         .                g.5093
 gggaggccgggccggccgggctgcgagcgcctgccccatgcgccgccgcctctccgcacg       c.-1

          .         .         .         .         . | 02       .    g.9071
 ATGTTCCCCTCGCGGAGGAAAGCGGCGCAGCTGCCCTGGGAGGACGGCAG | GTCCGGGTTG    c.60
 M  F  P  S  R  R  K  A  A  Q  L  P  W  E  D  G  R  |  S  G  L      p.20

          .         .         .         .         .         .       g.9131
 CTCTCCGGCGGCCTCCCTCGGAAGTGTTCCGTCTTCCACCTGTTCGTGGCCTGCCTCTCG       c.120
 L  S  G  G  L  P  R  K  C  S  V  F  H  L  F  V  A  C  L  S         p.40

          .         .         .         .         .         .       g.9191
 CTGGGCTTCTTCTCCCTACTCTGGCTGCAGCTCAGCTGCTCTGGGGACGTGGCCCGGGCA       c.180
 L  G  F  F  S  L  L  W  L  Q  L  S  C  S  G  D  V  A  R  A         p.60

          .         .         .         .         .         .       g.9251
 GTCAGGGGACAAGGGCAGGAGACCTCGGGCCCTCCCCGTGCCTGCCCCCCAGAGCCGCCC       c.240
 V  R  G  Q  G  Q  E  T  S  G  P  P  R  A  C  P  P  E  P  P         p.80

          .         .         .         .         .         .       g.9311
 CCTGAGCACTGGGAAGAAGACGCATCCTGGGGCCCCCACCGCCTGGCAGTGCTGGTGCCC       c.300
 P  E  H  W  E  E  D  A  S  W  G  P  H  R  L  A  V  L  V  P         p.100

          .         .         .         .         .         .       g.9371
 TTCCGCGAACGCTTCGAGGAGCTCCTGGTCTTCGTGCCCCACATGCGCCGCTTCCTGAGC       c.360
 F  R  E  R  F  E  E  L  L  V  F  V  P  H  M  R  R  F  L  S         p.120

          .         .         .         .         .    | 03    .    g.12191
 AGGAAGAAGATCCGGCACCACATCTACGTGCTCAACCAGGTGGACCACTTCAG | GTTCAAC    c.420
 R  K  K  I  R  H  H  I  Y  V  L  N  Q  V  D  H  F  R  |  F  N      p.140

          .         .         .         .         .         .       g.12251
 CGGGCAGCGCTCATCAACGTGGGCTTCCTGGAGAGCAGCAACAGCACGGACTACATTGCC       c.480
 R  A  A  L  I  N  V  G  F  L  E  S  S  N  S  T  D  Y  I  A         p.160

          .         .         .         .         .         .       g.12311
 ATGCACGACGTTGACCTGCTCCCTCTCAACGAGGAGCTGGACTATGGCTTTCCTGAGGCT       c.540
 M  H  D  V  D  L  L  P  L  N  E  E  L  D  Y  G  F  P  E  A         p.180

          .         .         .         .         .         .       g.12371
 GGGCCCTTCCACGTGGCCTCCCCGGAGCTCCACCCTCTCTACCACTACAAGACCTATGTC       c.600
 G  P  F  H  V  A  S  P  E  L  H  P  L  Y  H  Y  K  T  Y  V         p.200

          .         .         .          | 04        .         .    g.13442
 GGCGGCATCCTGCTGCTCTCCAAGCAGCACTACCGGCTG | TGCAATGGGATGTCCAACCGC    c.660
 G  G  I  L  L  L  S  K  Q  H  Y  R  L   | C  N  G  M  S  N  R      p.220

          .         .         .         .         .         .       g.13502
 TTCTGGGGCTGGGGCCGCGAGGACGACGAGTTCTACCGGCGCATTAAGGGAGCTGGGCTC       c.720
 F  W  G  W  G  R  E  D  D  E  F  Y  R  R  I  K  G  A  G  L         p.240

     | 05    .         .         .         .         .         .    g.13849
 CAG | CTTTTCCGCCCCTCGGGAATCACAACTGGGTACAAGACATTTCGCCACCTGCATGAC    c.780
 Q   | L  F  R  P  S  G  I  T  T  G  Y  K  T  F  R  H  L  H  D      p.260

          .         .         .         .         | 06         .    g.14434
 CCAGCCTGGCGGAAGAGGGACCAGAAGCGCATCGCAGCTCAAAAACAG | GAGCAGTTCAAG    c.840
 P  A  W  R  K  R  D  Q  K  R  I  A  A  Q  K  Q   | E  Q  F  K      p.280

          .         .         .         .         .         .       g.14494
 GTGGACAGGGAGGGAGGCCTGAACACTGTGAAGTACCATGTGGCTTCCCGCACTGCCCTG       c.900
 V  D  R  E  G  G  L  N  T  V  K  Y  H  V  A  S  R  T  A  L         p.300

          .         .         .         .         .         .       g.14554
 TCTGTGGGCGGGGCCCCCTGCACTGTCCTCAACATCATGTTGGACTGTGACAAGACCGCC       c.960
 S  V  G  G  A  P  C  T  V  L  N  I  M  L  D  C  D  K  T  A         p.320

          .         .                                               g.14578
 ACACCCTGGTGCACATTCAGCTGA                                           c.984
 T  P  W  C  T  F  S  X                                             p.327

          .         .         .         .         .         .       g.14638
 gctggatggacagtgaggaagcctgtacctacaggccatattgctcaggctcaggacaag       c.*60

          .         .         .         .         .         .       g.14698
 gcctcaggtcgtgggcccagctctgacaggatgtggagtggccaggaccaagacagcaag       c.*120

          .         .         .         .         .         .       g.14758
 ctacgcaattgcagccacccggccgccaaggcaggcttgggctgggccaggacacgtggg       c.*180

          .         .         .         .         .         .       g.14818
 gtgcctgggacgctgcttgccatgcacagtgatcagagagaggctggggtgtgtcctgtc       c.*240

          .         .         .         .         .         .       g.14878
 cgggaccccccctgccttcctgctcaccctactctgacctccttcacgtgcccaggcctg       c.*300

          .         .         .         .         .         .       g.14938
 tgggtagtggggagggctgaacaggacaacctctcatcacccccacttttgttccttcct       c.*360

          .         .         .         .         .         .       g.14998
 gctgggctgcctcgtgcagagacacagtgtaggggccatgcagctggcgtaggtggcagt       c.*420

          .         .         .         .         .         .       g.15058
 tgggcctggtgagggttaggacttcagaaaccagagcacaagccccacagagggggaaca       c.*480

          .         .         .         .         .         .       g.15118
 gccagcaccgctctagctggttgttgccatgccggaatgtgggcctagtgttgccagatc       c.*540

          .         .         .         .         .         .       g.15178
 ttctgatttttcgaaagaaactagaatgctggattcttaagtgatatcttctgatttttt       c.*600

          .         .         .         .         .                 g.15230
 aaatgatagcacctaaatgaaactttcaaaaagtatggcaggccagacaaaa               c.*652

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2013 Leiden University Medical Center