carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 (CHST14) - coding DNA reference sequence

(used for mutation description)

(last modified October 15, 2012)


This file was created to facilitate the description of sequence variants in the CHST14 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_017074.1, covering CHST14 transcript NM_130468.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5013
                                                ctgcgaggccggg       c.-241

 .         .         .         .         .         .                g.5073
 ggtggagagcggccgggcgggacatccggcccgggtccctcgccgcgcccgccgcccgcc       c.-181

 .         .         .         .         .         .                g.5133
 gcccgcttcggcgccgcagcccgggagccggccacccctacacgcgccagggctgtcccc       c.-121

 .         .         .         .         .         .                g.5193
 tgccctcccctccccaactacccccggtcccagaccctcctcccgcccccagcccgagcc       c.-61

 .         .         .         .         .         .                g.5253
 cgccttccaggccgccctcggatcggccgggcccgcgcaggcccccaccccttgagcacc       c.-1

          .         .         .         .         .         .       g.5313
 ATGTTCCCCCGCCCGCTGACCCCGCTGGCGGCCCCAAATGGCGCCGAGCCCCTGGGCCGG       c.60
 M  F  P  R  P  L  T  P  L  A  A  P  N  G  A  E  P  L  G  R         p.20

          .         .         .         .         .         .       g.5373
 GCGCTGAGGCGGGCCCCTCTGGGCAGGGCCCGGGCGGGGCTGGGTGGGCCGCCCCTGCTG       c.120
 A  L  R  R  A  P  L  G  R  A  R  A  G  L  G  G  P  P  L  L         p.40

          .         .         .         .         .         .       g.5433
 CTGCCGTCCATGCTGATGTTTGCGGTGATCGTGGCCTCCAGCGGGCTGCTGCTCATGATC       c.180
 L  P  S  M  L  M  F  A  V  I  V  A  S  S  G  L  L  L  M  I         p.60

          .         .         .         .         .         .       g.5493
 GAGCGGGGCATCCTGGCCGAGATGAAGCCCCTGCCCCTGCACCCGCCCGGCCGCGAGGGC       c.240
 E  R  G  I  L  A  E  M  K  P  L  P  L  H  P  P  G  R  E  G         p.80

          .         .         .         .         .         .       g.5553
 ACAGCCTGGCGCGGGAAAGCCCCCAAGCCTGGGGGCCTGTCCCTCAGGGCTGGGGACGCG       c.300
 T  A  W  R  G  K  A  P  K  P  G  G  L  S  L  R  A  G  D  A         p.100

          .         .         .         .         .         .       g.5613
 GACTTGCAAGTGCGGCAGGACGTCCGGAACAGGACCCTGCGGGCGGTGTGCGGACAGCCA       c.360
 D  L  Q  V  R  Q  D  V  R  N  R  T  L  R  A  V  C  G  Q  P         p.120

          .         .         .         .         .         .       g.5673
 GGCATGCCCCGGGACCCCTGGGACTTGCCGGTGGGGCAGCGGCGCACCCTGCTGCGCCAC       c.420
 G  M  P  R  D  P  W  D  L  P  V  G  Q  R  R  T  L  L  R  H         p.140

          .         .         .         .         .         .       g.5733
 ATCCTCGTAAGTGACCGTTACCGCTTCCTCTACTGCTACGTCCCCAAGGTGGCCTGCTCT       c.480
 I  L  V  S  D  R  Y  R  F  L  Y  C  Y  V  P  K  V  A  C  S         p.160

          .         .         .         .         .         .       g.5793
 AACTGGAAGCGGGTGATGAAGGTGCTGGCAGGCGTCCTGGACAGCGTGGACGTCCGCCTC       c.540
 N  W  K  R  V  M  K  V  L  A  G  V  L  D  S  V  D  V  R  L         p.180

          .         .         .         .         .         .       g.5853
 AAGATGGACCACCGCAGTGACCTGGTGTTCCTGGCCGACCTGCGGCCTGAGGAGATTCGC       c.600
 K  M  D  H  R  S  D  L  V  F  L  A  D  L  R  P  E  E  I  R         p.200

          .         .         .         .         .         .       g.5913
 TACCGCCTGCAGCACTACTTTAAGTTCCTGTTTGTGCGGGAGCCCTTGGAACGCCTCCTC       c.660
 Y  R  L  Q  H  Y  F  K  F  L  F  V  R  E  P  L  E  R  L  L         p.220

          .         .         .         .         .         .       g.5973
 TCTGCCTACCGCAACAAGTTTGGCGAGATCCGAGAGTACCAGCAACGCTATGGGGCTGAG       c.720
 S  A  Y  R  N  K  F  G  E  I  R  E  Y  Q  Q  R  Y  G  A  E         p.240

          .         .         .         .         .         .       g.6033
 ATAGTGAGGCGGTACAGGGCTGGAGCGGGGCCCAGCCCTGCAGGCGACGATGTCACATTC       c.780
 I  V  R  R  Y  R  A  G  A  G  P  S  P  A  G  D  D  V  T  F         p.260

          .         .         .         .         .         .       g.6093
 CCCGAGTTCCTGAGATACCTGGTGGATGAGGACCCTGAGCGCATGAATGAGCATTGGATG       c.840
 P  E  F  L  R  Y  L  V  D  E  D  P  E  R  M  N  E  H  W  M         p.280

          .         .         .         .         .         .       g.6153
 CCCGTGTACCACCTGTGCCAGCCTTGTGCCGTGCACTATGACTTTGTGGGCTCCTATGAG       c.900
 P  V  Y  H  L  C  Q  P  C  A  V  H  Y  D  F  V  G  S  Y  E         p.300

          .         .         .         .         .         .       g.6213
 AGGCTGGAGGCTGATGCAAATCAGGTGCTGGAGTGGGTACGGGCACCACCTCACGTCCGA       c.960
 R  L  E  A  D  A  N  Q  V  L  E  W  V  R  A  P  P  H  V  R         p.320

          .         .         .         .         .         .       g.6273
 TTTCCAGCTCGCCAGGCCTGGTACCGGCCAGCCAGCCCCGAAAGCCTGCATTACCACTTG       c.1020
 F  P  A  R  Q  A  W  Y  R  P  A  S  P  E  S  L  H  Y  H  L         p.340

          .         .         .         .         .         .       g.6333
 TGCAGTGCCCCCCGGGCCCTGCTGCAGGATGTGCTGCCTAAGTATATCCTGGACTTCTCC       c.1080
 C  S  A  P  R  A  L  L  Q  D  V  L  P  K  Y  I  L  D  F  S         p.360

          .         .         .         .         .                 g.6384
 CTCTTTGCCTACCCACTGCCTAATGTCACCAAGGAGGCGTGTCAGCAGTGA                c.1131
 L  F  A  Y  P  L  P  N  V  T  K  E  A  C  Q  Q  X                  p.376

          .         .         .         .         .         .       g.6444
 ccatgggtgtggggccagcagctggtggggactggtttcaacgccagctttctgtgcttc       c.*60

          .         .         .         .         .         .       g.6504
 tgcctgtcattcggagaaactctggctctggggcttggggcttctcaggatcctggatgg       c.*120

          .         .         .         .         .         .       g.6564
 cagagactgccctcagaagttccttgtccagggtgggcacccacagtgactcagaggaca       c.*180

          .         .         .         .         .         .       g.6624
 gggctaggcaggagacctgctgctcctcattggggggatctcttggggggcagacaccag       c.*240

          .         .         .         .         .         .       g.6684
 tttgccaatgaagcaacacatctgatctaaagactggctccagaccccgggctgccagga       c.*300

          .         .         .         .         .         .       g.6744
 ttatgcagtccacttggtctaccttaatttaacctgtggccaaactcagagatggtacca       c.*360

          .         .         .         .         .         .       g.6804
 gccaggggcaagcatgaccagagccagggaccctgtggctctgatcccccatttatccac       c.*420

          .         .         .         .         .         .       g.6864
 cccatgtgcctcaggactagagtgagcaatcataccttataaatgacttttgtgcctttc       c.*480

          .         .         .         .         .         .       g.6924
 tgctccagtctcaaaatttcctacacctgccagttctttacatttttccaaggaaaggaa       c.*540

          .         .         .         .         .         .       g.6984
 aacggaagcagggttcttgcctggtagctccaggacccagctctgcaggcacccaaagac       c.*600

          .         .         .         .         .         .       g.7044
 cctctgtgcccagcctcttccttgagttctcggaacctcctccctaattctcccttcctt       c.*660

          .         .         .         .         .         .       g.7104
 ccccacaaggcctttgaggttgtgactgtggctggtatatctggctgccatttttctgat       c.*720

          .         .         .         .         .         .       g.7164
 gcatttatttaaaatttgtactttttgatagaacccttgtaagggctttgttttcctaat       c.*780

          .         .         .                                     g.7198
 agctgactttttaataaagcagttttatatataa                                 c.*814

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center