collagen, type V, alpha 1 (COL5A1) - coding DNA reference sequence

(used for mutation description)

(last modified October 6, 2009)


This file was created to facilitate the description of sequence variants in the COL5A1 gene based on a coding DNA reference sequence following the HGVS recommendations.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5022
                                       cgcactctccgtccccgcggct       c.-361

 .         .         .         .         .         .                g.5082
 ggcgcaggacctcactcgagcggagcgcccacggggagcgggtcgcggggcggcggcggc       c.-301

 .         .         .         .         .         .                g.5142
 gaggaggaggcgagaaggagttggaggaggaggaggaggaggcgagggcgagctagccca       c.-241

 .         .         .         .         .         .                g.5202
 gcggggtcccggccgccccgcgggccaaagtcgagccctcccgcccgtgggcgagcgcgc       c.-181

 .         .         .         .         .         .                g.5262
 cagccgccccttccagaacagccgccgccacaaagaagaacggggggtgccgaggtcccc       c.-121

 .         .         .         .         .         .                g.5322
 atgacctcctaaagtggtgcggtccctgctgagtgcgctgcccgggccgtgacccgcgcc       c.-61

 .         .         .         .         .         .                g.5382
 cctgtgcgtccccgcgcgcctccgagcgcccctgtgcgccccggcccgcgccccgccggc       c.-1

          .         .         .         .         .         .       g.5442
 ATGGACGTCCATACCCGCTGGAAAGCGCGCAGCGCGCTCCGCCCGGGCGCCCCGCTGCTG       c.60
 M  D  V  H  T  R  W  K  A  R  S  A  L  R  P  G  A  P  L  L         p.20

          .         .         .         .          | 02        .    g.54117
 CCCCCGCTGCTGCTGCTGCTGCTGTGGGCGCCGCCTCCGAGCCGCGCAG | CTCAGCCAGCA    c.120
 P  P  L  L  L  L  L  L  W  A  P  P  P  S  R  A  A |   Q  P  A      p.40

          .         .         .         .         .         .       g.54177
 GATCTCCTGAAGGTTCTAGATTTTCACAACTTGCCTGATGGAATAACAAAGACAACAGGC       c.180
 D  L  L  K  V  L  D  F  H  N  L  P  D  G  I  T  K  T  T  G         p.60

          .         .         .         .         .         .       g.54237
 TTTTGCGCCACGCGGCGATCTTCCAAAGGCCCGGATGTCGCTTACAGAGTCACCAAAGAC       c.240
 F  C  A  T  R  R  S  S  K  G  P  D  V  A  Y  R  V  T  K  D         p.80

          .         .         .        | 03.         .         .    g.63126
 GCGCAGCTCAGCGCACCCACCAAGCAGCTGTACCCTG | CGTCTGCATTTCCCGAGGACTTC    c.300
 A  Q  L  S  A  P  T  K  Q  L  Y  P  A |   S  A  F  P  E  D  F      p.100

          .         .         .         .         .         .       g.63186
 TCCATCCTAACAACTGTGAAAGCCAAGAAAGGCAGCCAGGCCTTCCTGGTCTCCATCTAC       c.360
 S  I  L  T  T  V  K  A  K  K  G  S  Q  A  F  L  V  S  I  Y         p.120

          .         .         .         .         .         .       g.63246
 AACGAGCAGGGTATCCAGCAGATTGGGCTGGAGCTGGGCCGCTCTCCCGTCTTCCTCTAC       c.420
 N  E  Q  G  I  Q  Q  I  G  L  E  L  G  R  S  P  V  F  L  Y         p.140

          .         .         .         .         .         .       g.63306
 GAGGACCACACGGGGAAGCCTGGCCCGGAAGACTACCCCCTCTTCCGGGGCATCAACCTG       c.480
 E  D  H  T  G  K  P  G  P  E  D  Y  P  L  F  R  G  I  N  L         p.160

          .  | 04      .         .         .         .         .    g.64414
 TCAGATGGCAA | GTGGCACAGAATTGCTCTCAGCGTCCACAAGAAAAATGTCACCTTGATC    c.540
 S  D  G  K  |  W  H  R  I  A  L  S  V  H  K  K  N  V  T  L  I      p.180

          .         .         .         .         .         .       g.64474
 CTCGACTGTAAAAAGAAGACCACCAAATTCCTCGACCGCAGCGACCACCCCATGATCGAC       c.600
 L  D  C  K  K  K  T  T  K  F  L  D  R  S  D  H  P  M  I  D         p.200

          .         .         .         .         .     | 05   .    g.90466
 ATCAATGGCATCATCGTGTTTGGCACCCGGATCCTGGATGAGGAGGTGTTTGAG | GGTGAC    c.660
 I  N  G  I  I  V  F  G  T  R  I  L  D  E  E  V  F  E   | G  D      p.220

          .         .         .         .         .         .       g.90526
 ATCCAGCAGCTGCTCTTTGTCTCGGACCACCGGGCAGCTTATGATTACTGTGAGCACTAC       c.720
 I  Q  Q  L  L  F  V  S  D  H  R  A  A  Y  D  Y  C  E  H  Y         p.240

          .         .         .         .         .         .       g.90586
 AGCCCTGACTGTGACACCGCAGTACCTGACACCCCACAGTCGCAGGACCCCAATCCAGAT       c.780
 S  P  D  C  D  T  A  V  P  D  T  P  Q  S  Q  D  P  N  P  D         p.260

        | 06 .         .         .         .         .         .    g.91918
 GAATAT | TACACGGAAGGAGACGGCGAGGGTGAGACCTATTACTACGAATACCCCTACTAC    c.840
 E  Y   | Y  T  E  G  D  G  E  G  E  T  Y  Y  Y  E  Y  P  Y  Y      p.280

          .         .         .         .         .         .       g.91978
 GAAGACCCCGAAGACCTAGGGAAGGAGCCCACCCCCAGCAAGAAGCCCGTGGAAGCTGCC       c.900
 E  D  P  E  D  L  G  K  E  P  T  P  S  K  K  P  V  E  A  A         p.300

          .         .     | 07   .         .         .         .    g.93466
 AAAGAAACCACAGAGGTCCCCGAG | GAGCTGACCCCGACCCCCACGGAAGCTGCTCCCATG    c.960
 K  E  T  T  E  V  P  E   | E  L  T  P  T  P  T  E  A  A  P  M      p.320

          .         .         .         .         .         .       g.93526
 CCTGAAACCAGTGAAGGGGCTGGGAAGGAAGAGGACGTCGGCATCGGGGACTATGACTAC       c.1020
 P  E  T  S  E  G  A  G  K  E  E  D  V  G  I  G  D  Y  D  Y         p.340

          .         .         .         .         .         .       g.93586
 GTGCCCAGTGAGGACTACTACACGCCCTCACCGTATGATGACCTCACCTATGGCGAGGGG       c.1080
 V  P  S  E  D  Y  Y  T  P  S  P  Y  D  D  L  T  Y  G  E  G         p.360

          .         .         .         .         .         .       g.93646
 GAGGAGAACCCCGACCAGCCCACAGACCCAGGCGCTGGGGCCGAAATTCCCACCAGCACC       c.1140
 E  E  N  P  D  Q  P  T  D  P  G  A  G  A  E  I  P  T  S  T         p.380

          .         .     | 08   .         .         .         .    g.94726
 GCCGACACCTCCAACTCCTCCAAT | CCAGCTCCGCCTCCAGGGGAAGGTGCGGATGACTTG    c.1200
 A  D  T  S  N  S  S  N   | P  A  P  P  P  G  E  G  A  D  D  L      p.400

          .         .         .         .         .         .       g.94786
 GAGGGGGAGTTCACTGAGGAAACGATCCGGAACCTTGACGAGAACTACTACGACCCCTAC       c.1260
 E  G  E  F  T  E  E  T  I  R  N  L  D  E  N  Y  Y  D  P  Y         p.420

          .         .         .         .         .         .       g.94846
 TACGACCCCACCAGCTCCCCGTCGGAGATCGGGCCGGGAATGCCGGCGAACCAGGATACC       c.1320
 Y  D  P  T  S  S  P  S  E  I  G  P  G  M  P  A  N  Q  D  T         p.440

          .   | 09     .         .         .         .         .    g.95313
 ATCTATGAAGGG | ATTGGAGGACCTCGGGGCGAGAAAGGCCAAAAGGGAGAACCAGCGATT    c.1380
 I  Y  E  G   | I  G  G  P  R  G  E  K  G  Q  K  G  E  P  A  I      p.460

           | 10        .         .         .         .  | 11      . g.101949
 ATCGAGCCG | GGCATGCTCATCGAGGGCCCGCCTGGCCCAGAAGGCCCCGCG | GGTCTTCCC c.1440
 I  E  P   | G  M  L  I  E  G  P  P  G  P  E  G  P  A   | G  L  P   p.480

          .         .         .         .         .     | 12   .    g.113742
 GGACCTCCAGGAACCATGGGTCCCACTGGCCAAGTCGGGGACCCTGGAGAAAGG | GGCCCC    c.1500
 G  P  P  G  T  M  G  P  T  G  Q  V  G  D  P  G  E  R   | G  P      p.500

          .         .         .         .         .         .       g.113802
 CCTGGACGCCCAGGCCTTCCTGGGGCCGATGGCCTGCCCGGTCCTCCAGGAACCATGCTC       c.1560
 P  G  R  P  G  L  P  G  A  D  G  L  P  G  P  P  G  T  M  L         p.520

           | 13        .         .         .         .         .    g.114035
 ATGCTGCCC | TTCCGGTTTGGAGGTGGCGGCGATGCGGGCTCCAAAGGCCCCATGGTCTCA    c.1620
 M  L  P   | F  R  F  G  G  G  G  D  A  G  S  K  G  P  M  V  S      p.540

          .         .         .         .   | 14     .         .    g.115801
 GCCCAGGAGTCCCAGGCGCAAGCCATTCTCCAGCAGGCCAGG | TTGGCACTGAGGGGACCA    c.1680
 A  Q  E  S  Q  A  Q  A  I  L  Q  Q  A  R   | L  A  L  R  G  P      p.560

          .         .         .          | 15        .         .    g.117065
 GCTGGCCCGATGGGTCTCACAGGGAGACCTGGCCCTGTG | GGTCCCCCTGGGAGCGGAGGT    c.1740
 A  G  P  M  G  L  T  G  R  P  G  P  V   | G  P  P  G  S  G  G      p.580

          .         .         .    | 16    .         .         .    g.117494
 TTGAAGGGCGAGCCGGGAGACGTGGGGCCTCAG | GGTCCTCGAGGTGTGCAAGGCCCGCCT    c.1800
 L  K  G  E  P  G  D  V  G  P  Q   | G  P  R  G  V  Q  G  P  P      p.600

          .         .        | 17.         .         .         .    g.119992
 GGTCCGGCCGGGAAGCCCGGAAGACGG | GGTCGGGCTGGGAGTGATGGAGCCAGAGGAATG    c.1860
 G  P  A  G  K  P  G  R  R   | G  R  A  G  S  D  G  A  R  G  M      p.620

          .         .  | 18      .         .         .         .    g.121476
 CCTGGACAAACTGGCCCCAAG | GGTGACCGGGGTTTCGACGGCCTGGCTGGGTTGCCAGGC    c.1920
 P  G  Q  T  G  P  K   | G  D  R  G  F  D  G  L  A  G  L  P  G      p.640

          .      | 19  .         .         .         .         .    g.125164
 GAGAAGGGCCACAGG | GGTGACCCTGGTCCTTCCGGCCCACCAGGACCTCCGGGAGACGAT    c.1980
 E  K  G  H  R   | G  D  P  G  P  S  G  P  P  G  P  P  G  D  D      p.660

           | 20        .         .         .         .     | 21   . g.128881
 GGAGAAAGG | GGTGACGACGGAGAAGTTGGGCCCAGGGGGCTGCCTGGGGAGCCC | GGGCCA c.2040
 G  E  R   | G  D  D  G  E  V  G  P  R  G  L  P  G  E  P   | G  P   p.680

          .         .         .         .         | 22         .    g.129660
 CGTGGTCTGCTTGGGCCGAAGGGGCCCCCAGGTCCTCCCGGACCTCCC | GGTGTCACGGGT    c.2100
 R  G  L  L  G  P  K  G  P  P  G  P  P  G  P  P   | G  V  T  G      p.700

          .         .         .    | 23    .         .         .    g.130221
 ATGGACGGCCAGCCGGGGCCAAAAGGAAATGTG | GGTCCCCAGGGAGAGCCTGGCCCCCCA    c.2160
 M  D  G  Q  P  G  P  K  G  N  V   | G  P  Q  G  E  P  G  P  P      p.720

          .         .        | 24.         .         .         .    g.130537
 GGACAGCAGGGTAATCCAGGCGCCCAG | GGTCTTCCAGGCCCCCAGGGTGCAATTGGTCCT    c.2220
 G  Q  Q  G  N  P  G  A  Q   | G  L  P  G  P  Q  G  A  I  G  P      p.740

          .   | 25     .         .         .         .         .    g.131652
 CCAGGAGAAAAG | GGTCCCTTGGGGAAACCAGGCCTTCCAGGAATGCCCGGTGCTGACGGA    c.2280
 P  G  E  K   | G  P  L  G  K  P  G  L  P  G  M  P  G  A  D  G      p.760

        | 26 .         .         .         .         .  | 27      . g.138062
 CCCCCG | GGACACCCTGGCAAAGAAGGCCCTCCAGGAGAGAAAGGAGGTCAG | GGTCCACCT c.2340
 P  P   | G  H  P  G  K  E  G  P  P  G  E  K  G  G  Q   | G  P  P   p.780

          .         .         .         .      | 28  .         .    g.143311
 GGCCCCCAGGGTCCGATTGGCTACCCAGGTCCTCGAGGAGTCAAG | GGGGCCGATGGCATC    c.2400
 G  P  Q  G  P  I  G  Y  P  G  P  R  G  V  K   | G  A  D  G  I      p.800

          .         .         . | 29       .         .         .    g.145891
 CGTGGTCTGAAGGGCACAAAGGGCGAGAAG | GGTGAAGACGGCTTTCCTGGGTTTAAAGGA    c.2460
 R  G  L  K  G  T  K  G  E  K   | G  E  D  G  F  P  G  F  K  G      p.820

          .         .     | 30   .         .         .         .    g.148219
 GACATGGGCATCAAGGGTGATCGG | GGGGAGATCGGCCCACCCGGTCCCAGGGGAGAAGAT    c.2520
 D  M  G  I  K  G  D  R   | G  E  I  G  P  P  G  P  R  G  E  D      p.840

          .         .         .         .         .         .       g.148279
 GGCCCTGAAGGCCCAAAGGGTCGCGGAGGTCCCAATGGTGACCCCGGTCCTCTGGGACCC       c.2580
 G  P  E  G  P  K  G  R  G  G  P  N  G  D  P  G  P  L  G  P         p.860

          .   | 31     .         .         .         .         .    g.149237
 CCTGGGGAGAAG | GGAAAACTCGGAGTCCCAGGGTTACCAGGGTATCCAGGAAGACAAGGA    c.2640
 P  G  E  K   | G  K  L  G  V  P  G  L  P  G  Y  P  G  R  Q  G      p.880

        | 32 .         .         .         .         .         .    g.152403
 CCAAAG | GGCTCTATTGGATTCCCTGGATTTCCTGGCGCCAATGGAGAGAAGGGCGGCAGG    c.2700
 P  K   | G  S  I  G  F  P  G  F  P  G  A  N  G  E  K  G  G  R      p.900

  | 33       .         .         .         .      | 34  .         . g.158471
  | GGGACCCCTGGAAAGCCAGGACCGCGGGGGCAGCGAGGCCCAACG | GGTCCGAGGGGTGAA c.2760
  | G  T  P  G  K  P  G  P  R  G  Q  R  G  P  T   | G  P  R  G  E   p.920

          .         .         .          | 35        .         .    g.159589
 AGAGGCCCCCGGGGCATCACTGGGAAGCCTGGCCCCAAG | GGCAACTCCGGAGGTGACGGC    c.2820
 R  G  P  R  G  I  T  G  K  P  G  P  K   | G  N  S  G  G  D  G      p.940

          .         .     | 36   .         .         .         .    g.160078
 CCAGCTGGCCCTCCTGGTGAACGG | GGACCCAATGGACCCCAAGGACCCACAGGATTTCCT    c.2880
 P  A  G  P  P  G  E  R   | G  P  N  G  P  Q  G  P  T  G  F  P      p.960

          .         | 37         .         .         .         .    g.161644
 GGACCAAAGGGCCCCCCT | GGCCCTCCAGGCAAGGATGGACTCCCAGGACACCCTGGACAG    c.2940
 G  P  K  G  P  P   | G  P  P  G  K  D  G  L  P  G  H  P  G  Q      p.980

          .   | 38     .         .         .         .         .    g.165196
 AGAGGCGAGACT | GGTTTCCAAGGCAAGACCGGCCCTCCAGGCCCCCCCGGCGTGGTCGGC    c.3000
 R  G  E  T   | G  F  Q  G  K  T  G  P  P  G  P  P  G  V  V  G      p.1000

        | 39 .         .         .         .         .         .    g.166136
 CCTCAG | GGTCCCACGGGAGAAACGGGCCCAATGGGTGAGCGTGGCCACCCTGGGCCCCCT    c.3060
 P  Q   | G  P  T  G  E  T  G  P  M  G  E  R  G  H  P  G  P  P      p.1020

          .         .         .         .         .     | 40   .    g.168175
 GGACCCCCCGGTGAACAGGGGCTTCCGGGCCTTGCTGGAAAAGAAGGGACGAAG | GGTGAC    c.3120
 G  P  P  G  E  Q  G  L  P  G  L  A  G  K  E  G  T  K   | G  D      p.1040

          .         .         .         .         .         .       g.168235
 CCAGGCCCTGCAGGCCTCCCTGGGAAAGATGGCCCTCCAGGATTACGTGGTTTCCCTGGG       c.3180
 P  G  P  A  G  L  P  G  K  D  G  P  P  G  L  R  G  F  P  G         p.1060

          .         .     | 41   .         .         .         .    g.168391
 GACCGAGGGCTTCCTGGTCCAGTG | GGAGCTCTTGGACTGAAAGGCAATGAAGGGCCCCCT    c.3240
 D  R  G  L  P  G  P  V   | G  A  L  G  L  K  G  N  E  G  P  P      p.1080

          .         | 42         .         .         .         .    g.169425
 GGCCCACCAGGCCCTGCG | GGATCTCCAGGGGAGAGAGGTCCAGCTGGAGCCGCTGGGCCC    c.3300
 G  P  P  G  P  A   | G  S  P  G  E  R  G  P  A  G  A  A  G  P      p.1100

          .         .         .         .         .         .       g.169485
 ATCGGAATTCCAGGGAGACCTGGGCCCCAGGGACCCCCAGGGCCGGCAGGAGAGAAAGGG       c.3360
 I  G  I  P  G  R  P  G  P  Q  G  P  P  G  P  A  G  E  K  G         p.1120

        | 43 .         .         .         .         .         .    g.172431
 GCTCCT | GGCGAGAAAGGCCCACAAGGCCCAGCTGGCCGAGACGGTCTCCAGGGGCCTGTG    c.3420
 A  P   | G  E  K  G  P  Q  G  P  A  G  R  D  G  L  Q  G  P  V      p.1140

          .         .         .         .         .     | 44   .    g.173455
 GGGCTCCCGGGTCCAGCTGGCCCTGTGGGTCCCCCTGGAGAAGACGGAGATAAG | GGAGAG    c.3480
 G  L  P  G  P  A  G  P  V  G  P  P  G  E  D  G  D  K   | G  E      p.1160

          .         .         .         .         | 45         .    g.174545
 ATCGGGGAGCCGGGGCAGAAAGGAAGCAAGGGGGACAAAGGAGAACAG | GGTCCTCCTGGG    c.3540
 I  G  E  P  G  Q  K  G  S  K  G  D  K  G  E  Q   | G  P  P  G      p.1180

          .         .         .         .   | 46     .         .    g.174704
 CCTACAGGTCCTCAAGGCCCCATCGGACAGCCAGGCCCCTCT | GGAGCTGACGGCGAGCCG    c.3600
 P  T  G  P  Q  G  P  I  G  Q  P  G  P  S   | G  A  D  G  E  P      p.1200

          .         .         .         .         .         .       g.174764
 GGGCCTCGGGGCCAGCAGGGCCTTTTCGGGCAGAAAGGTGATGAAGGTCCCAGAGGCTTT       c.3660
 G  P  R  G  Q  Q  G  L  F  G  Q  K  G  D  E  G  P  R  G  F         p.1220

          .         .         . | 47       .         .         .    g.175673
 CCTGGACCCCCTGGGCCAGTGGGGCTGCAG | GGTTTGCCAGGACCTCCAGGCGAGAAGGGT    c.3720
 P  G  P  P  G  P  V  G  L  Q   | G  L  P  G  P  P  G  E  K  G      p.1240

          .         .     | 48   .         .         .         .    g.175835
 GAGACAGGAGACGTGGGCCAGATG | GGCCCCCCGGGTCCCCCTGGCCCCCGAGGACCCTCC    c.3780
 E  T  G  D  V  G  Q  M   | G  P  P  G  P  P  G  P  R  G  P  S      p.1260

          .         .         .         .         .         .       g.175895
 GGAGCTCCAGGTGCTGATGGCCCACAAGGTCCCCCAGGTGGAATAGGAAACCCTGGTGCA       c.3840
 G  A  P  G  A  D  G  P  Q  G  P  P  G  G  I  G  N  P  G  A         p.1280

          .   | 49     .         .         .         .         .    g.177225
 GTGGGAGAGAAG | GGCGAGCCTGGCGAAGCAGGTGAGCCTGGCCTTCCGGGAGAAGGCGGC    c.3900
 V  G  E  K   | G  E  P  G  E  A  G  E  P  G  L  P  G  E  G  G      p.1300

        | 50 .         .         .         .         .         .    g.178045
 CCCCCG | GGACCCAAAGGAGAAAGGGGAGAGAAGGGCGAGTCAGGCCCTTCAGGTGCTGCC    c.3960
 P  P   | G  P  K  G  E  R  G  E  K  G  E  S  G  P  S  G  A  A      p.1320

          .         .         .         .         .     | 51   .    g.178776
 GGACCCCCTGGACCCAAAGGCCCTCCCGGAGATGATGGTCCCAAAGGCAGCCCT | GGCCCA    c.4020
 G  P  P  G  P  K  G  P  P  G  D  D  G  P  K  G  S  P   | G  P      p.1340

          .         .         .         .         | 52         .    g.179141
 GTGGGTTTTCCTGGAGATCCTGGCCCCCCCGGAGAGCCTGGCCCCGCG | GGTCAAGATGGT    c.4080
 V  G  F  P  G  D  P  G  P  P  G  E  P  G  P  A   | G  Q  D  G      p.1360

          .         .         .         .   | 53     .         .    g.180238
 CCCCCTGGTGACAAAGGAGATGATGGTGAACCCGGGCAGACG | GGATCCCCCGGCCCTACT    c.4140
 P  P  G  D  K  G  D  D  G  E  P  G  Q  T   | G  S  P  G  P  T      p.1380

          .         .         .       | 54 .         .         .    g.180996
 GGTGAACCAGGTCCATCGGGGCCTCCAGGAAAAAGG | GGTCCCCCAGGCCCCGCAGGCCCC    c.4200
 G  E  P  G  P  S  G  P  P  G  K  R   | G  P  P  G  P  A  G  P      p.1400

          .         .         . | 55       .         .         .    g.181880
 GAAGGCAGACAGGGAGAGAAAGGGGCCAAG | GGAGAAGCCGGCTTGGAAGGCCCTCCTGGG    c.4260
 E  G  R  Q  G  E  K  G  A  K   | G  E  A  G  L  E  G  P  P  G      p.1420

          .         .         .         .         .         .       g.181940
 AAGACTGGCCCCATCGGCCCCCAGGGGGCCCCTGGGAAGCCCGGACCGGATGGCCTTCGA       c.4320
 K  T  G  P  I  G  P  Q  G  A  P  G  K  P  G  P  D  G  L  R         p.1440

          .         | 56         .         .         .         .    g.182084
 GGGATCCCTGGCCCTGTG | GGAGAACAAGGTCTCCCAGGATCCCCAGGCCCGGACGGTCCC    c.4380
 G  I  P  G  P  V   | G  E  Q  G  L  P  G  S  P  G  P  D  G  P      p.1460

          .   | 57     .         .         .         .         .    g.182242
 CCCGGCCCCATG | GGTCCCCCAGGACTTCCCGGCCTCAAAGGAGATTCTGGTCCCAAAGGT    c.4440
 P  G  P  M   | G  P  P  G  L  P  G  L  K  G  D  S  G  P  K  G      p.1480

        | 58 .         .         .         .         .         .    g.183364
 GAAAAG | GGTCATCCAGGCCTGATCGGGCTCATCGGTCCTCCGGGTGAACAGGGTGAGAAG    c.4500
 E  K   | G  H  P  G  L  I  G  L  I  G  P  P  G  E  Q  G  E  K      p.1500

          .         .         .         .         .     | 59   .    g.185297
 GGCGACCGTGGTCTCCCTGGCCCCCAGGGCTCCTCCGGTCCTAAGGGAGAACAG | GGTATC    c.4560
 G  D  R  G  L  P  G  P  Q  G  S  S  G  P  K  G  E  Q   | G  I      p.1520

          .         .         .         .         | 60         .    g.186204
 ACTGGTCCTTCTGGCCCGATTGGGCCTCCTGGGCCCCCTGGCCTGCCG | GGTCCGCCTGGT    c.4620
 T  G  P  S  G  P  I  G  P  P  G  P  P  G  L  P   | G  P  P  G      p.1540

          .         .     | 61   .         .         .         .    g.186646
 CCAAAAGGTGCTAAGGGCTCCTCG | GGTCCAACTGGCCCGAAGGGTGAGGCAGGCCACCCA    c.4680
 P  K  G  A  K  G  S  S   | G  P  T  G  P  K  G  E  A  G  H  P      p.1560

          .         | 62         .         .         .         .    g.187836
 GGACCCCCAGGCCCCCCG | GGCCCCCCGGGAGAGGTCATCCAGCCCCTGCCAATCCAGGCA    c.4740
 G  P  P  G  P  P   | G  P  P  G  E  V  I  Q  P  L  P  I  Q  A      p.1580

          .         .         .         .         .         .       g.187896
 TCCAGGACGCGGCGGAACATCGACGCCAGCCAGCTGCTGGACGACGGGAATGGCGAGAAC       c.4800
 S  R  T  R  R  N  I  D  A  S  Q  L  L  D  D  G  N  G  E  N         p.1600

          .         .         .         .         .         .       g.187956
 TACGTGGACTACGCGGACGGCATGGAAGAGATCTTCGGCTCTCTCAACTCTCTGAAGCTG       c.4860
 Y  V  D  Y  A  D  G  M  E  E  I  F  G  S  L  N  S  L  K  L         p.1620

          .         .         .         .         .         .       g.188016
 GAGATTGAGCAGATGAAACGGCCCCTGGGCACGCAGCAGAACCCCGCCCGCACCTGCAAG       c.4920
 E  I  E  Q  M  K  R  P  L  G  T  Q  Q  N  P  A  R  T  C  K         p.1640

          .         .         .     | 63   .         .         .    g.189012
 GACCTGCAGCTCTGCCACCCCGACTTCCCAGATG | GTGAATACTGGGTCGATCCTAACCAA    c.4980
 D  L  Q  L  C  H  P  D  F  P  D  G |   E  Y  W  V  D  P  N  Q      p.1660

          .         .         .         .         .         .       g.189072
 GGATGCTCCAGGGATTCCTTCAAGGTTTACTGCAACTTCACAGCCGGGGGGTCGACATGC       c.5040
 G  C  S  R  D  S  F  K  V  Y  C  N  F  T  A  G  G  S  T  C         p.1680

          .         .        | 64.         .         .         .    g.193203
 GTCTTCCCTGACAAGAAGTCCGAAGGG | GCCAGAATCACTTCTTGGCCCAAAGAAAACCCG    c.5100
 V  F  P  D  K  K  S  E  G   | A  R  I  T  S  W  P  K  E  N  P      p.1700

          .         .         .       | 65 .         .         .    g.198189
 GGCTCCTGGTTCAGTGAATTCAAGCGTGGGAAACTG | CTCTCCTATGTGGACGCCGAGGGC    c.5160
 G  S  W  F  S  E  F  K  R  G  K  L   | L  S  Y  V  D  A  E  G      p.1720

          .         .         .         .         .         .       g.198249
 AACCCTGTGGGTGTGGTACAGATGACCTTCCTGCGGCTGCTGAGCGCCTCTGCCCACCAG       c.5220
 N  P  V  G  V  V  Q  M  T  F  L  R  L  L  S  A  S  A  H  Q         p.1740

          .         .         .         .         .         .       g.198309
 AACGTCACCTACCACTGCTACCAGTCAGTGGCCTGGCAGGACGCAGCCACGGGCAGCTAC       c.5280
 N  V  T  Y  H  C  Y  Q  S  V  A  W  Q  D  A  A  T  G  S  Y         p.1760

          .         .         .         .         .         .       g.198369
 GACAAGGCCCTCCGCTTCCTGGGCTCCAACGACGAGGAGATGTCCTATGACAACAACCCC       c.5340
 D  K  A  L  R  F  L  G  S  N  D  E  E  M  S  Y  D  N  N  P         p.1780

          .         .         . | 66       .         .         .    g.205381
 TACATCCGCGCCCTGGTGGACGGCTGTGCT | ACCAAGAAAGGCTACCAGAAGACGGTTCTG    c.5400
 Y  I  R  A  L  V  D  G  C  A   | T  K  K  G  Y  Q  K  T  V  L      p.1800

          .         .         .         .         .         .       g.205441
 GAGATCGACACCCCCAAAGTGGAGCAGGTGCCCATCGTGGACATCATGTTCAATGACTTC       c.5460
 E  I  D  T  P  K  V  E  Q  V  P  I  V  D  I  M  F  N  D  F         p.1820

          .         .         .         .         .                 g.205498
 GGTGAAGCGTCACAGAAATTTGGATTTGAAGTGGGGCCGGCTTGCTTCATGGGCTAG          c.5517
 G  E  A  S  Q  K  F  G  F  E  V  G  P  A  C  F  M  G  X            p.1838

          .         .         .         .         .         .       g.205558
 gagccgccgagcccgggctcccgagagcaacctcgtgacctcagcatgccattcgttcgt       c.*60

          .         .         .         .         .         .       g.205618
 gagtgtcccgtgcacgtcctgaccctggacagtgaaggcttctccctcccctcccacctg       c.*120

          .         .         .         .         .         .       g.205678
 acttcatctacgcctcggcaccacggggtgtgggaccccagcccggagagaacagaggga       c.*180

          .         .         .         .         .         .       g.205738
 aggagccgcgcccccacctggagctgaatcacatgacctagctgcaccccagcgcctggg       c.*240

          .         .         .         .         .         .       g.205798
 cccgccccacgctctgtccacacccacgcgccccgggagcggggccatgcctccagcccc       c.*300

          .         .         .         .         .         .       g.205858
 ccagctcgcccgacccatcctgttcgtgaataggtctcaggggttgggggagggactgcc       c.*360

          .         .         .         .         .         .       g.205918
 agatttggacactatatttttttctaaattcaacttgaagatgtgtatttcccctgacct       c.*420

          .         .         .         .         .         .       g.205978
 tcaaaaaatgttccaaggtaagcctcgtaaaggtcatcccaccatcaccaaagcctccgt       c.*480

          .         .         .         .         .         .       g.206038
 ttttaacaacctccaacacgatccatttagaggccaaatgtcattctgcaggtgccttcc       c.*540

          .         .         .         .         .         .       g.206098
 cgatggattaaaggtgcttatgtttttgtgagttttaagtaaatatttgtattgtattgt       c.*600

          .         .         .         .         .         .       g.206158
 tataaatgttaagtgtgcctggctttcaatcatgcacggaaacccagtctcagtcccacg       c.*660

          .         .         .         .         .         .       g.206218
 gacagaatgggcgaggcatggattctgggttgcagtaccgttctgattagaaataggaag       c.*720

          .         .         .         .         .         .       g.206278
 tctccccacccccgccctggccaagaacgtgcaataaattggaagtttgccccggggcag       c.*780

          .         .         .         .         .         .       g.206338
 caagaatttatgctgccattgaaaagcaggtaccagtgccccttttcagacagtttttga       c.*840

          .         .         .         .         .         .       g.206398
 ttcgctctagactttttttttttttaatagggaaaaaatttgataattttcttttttcta       c.*900

          .         .         .         .         .         .       g.206458
 catgcacttaagactaaaacacaggtttggattaattttatttgcttcctttttccgctt       c.*960

          .         .         .         .         .         .       g.206518
 ttcttcccgcagagcctgatgggagaatgtccagggcagggaaaccacattttttgtagg       c.*1020

          .         .         .         .         .         .       g.206578
 tgataactcaatgaaaattggtgcttattttttacacttctctcttgtggctctcttgtg       c.*1080

          .         .         .         .         .         .       g.206638
 gtgctatctatctgttttaaggtctccttgaaggcgcactggggaccctggccatgcctc       c.*1140

          .         .         .         .         .         .       g.206698
 gttctccctgctttctttatcctgttattgcctccacagtctgttgccaaggactctaag       c.*1200

          .         .         .         .         .         .       g.206758
 atcaatgcacgtcactttcctttccactgggcaggatagccaagcacactccctcctgcg       c.*1260

          .         .         .         .         .         .       g.206818
 ctctcccgccccggtgcgtccactcccgagggctgttatgaggactgggttgtgcctact       c.*1320

          .         .         .         .         .         .       g.206878
 tgatttgaaaacacacacaagcaataaaaagcctcttcctgcattgtctgtggtgtgacc       c.*1380

          .         .         .         .         .         .       g.206938
 atagcagattatatttggttcctgaatgtttgtggtgctaatttctgtgtttgttccaag       c.*1440

          .         .         .         .         .         .       g.206998
 ccgttcagtcatgccatgcgctgcctcggtagatggagtaatgtacaatgaactccatga       c.*1500

          .         .         .         .         .         .       g.207058
 gtctctccagggctgcctgcagcacgtcttttccaagtagcctatttggattcccatctc       c.*1560

          .         .         .         .         .         .       g.207118
 aaatgtcctggatgcgagcgtcagcggctccagagctcggggcgggtgaggtcccctttg       c.*1620

          .         .         .         .         .         .       g.207178
 gggaaccctttcctggccatcgaggtcggggggctgccgtctgtgggcaggaggacccga       c.*1680

          .         .         .         .         .         .       g.207238
 ggggcagccaggaaaggcgatctcttcactgtgaaaagttgcccgggtgcagcgcctttt       c.*1740

          .         .         .         .         .         .       g.207298
 ccttctaccatgggaaatgcaggctgggcccttggggtgagcctgcggggctctggtgct       c.*1800

          .         .         .         .         .         .       g.207358
 gtccccgacccccaccaccaccagaatgcagttccagcttaggaagccacaaacaagcca       c.*1860

          .         .         .         .         .         .       g.207418
 cccaggaggaacaaaacaccgccagcgtggattttccaaatttccctggaaagtaagtct       c.*1920

          .         .         .         .         .         .       g.207478
 cgctcttgccaaagaaaagtctggcttggagagtctctggagcccaggatgccagcatgt       c.*1980

          .         .         .         .         .         .       g.207538
 gccaatgactgtcaccttcatctcttcaaaagaaaagccatagccgaggactgtcccgcg       c.*2040

          .         .         .         .         .         .       g.207598
 acccccgtggactgcgtctaggtcatgtgattctgttttcatttctcatcccatccaatt       c.*2100

          .         .         .         .         .         .       g.207658
 tgtccttttctcctgtcattttcttcctctgtggtcccttcaaagttgttataatttgta       c.*2160

          .         .         .         .         .         .       g.207718
 ctgaacttcaaaatgtgtcccgttctccccagaccactctagccacagtatattgcaata       c.*2220

          .         .         .         .         .         .       g.207778
 aaattacttcttatatttgcagaaattcttttggtgtaattttattttttcctctcaata       c.*2280

          .         .         .         .         .         .       g.207838
 tatataattggacaaacgctggcaaaaagaaaaaaatggtaagcaaaaaacccaagataa       c.*2340

          .         .         .         .         .         .       g.207898
 agtttcgaggacatcaggccttttgaaatacaatgtcaaatgacacattgtacggtttca       c.*2400

          .         .         .         .         .         .       g.207958
 aaaaatccgctagacatgtcataagttttaactgtaatgcccaggaaaggatatcttaaa       c.*2460

          .         .         .         .         .         .       g.208018
 atattctaaacttgtgtaacaaaggaataattaactgtaatagtttttcaataaatcgag       c.*2520

          .         .                                               g.208038
 ttgggtgtttccaccgtaaa                                               c.*2540

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Collagen, type V, alpha 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.2.0-21 Build 21
©2004-2009 Leiden University Medical Center