collagen, type V, alpha 2 (COL5A2) - coding DNA reference sequence

(used for mutation description)

(last modified October 27, 2009)


This file was created to facilitate the description of sequence variants in the COL5A2 gene based on a coding DNA reference sequence following the HGVS recommendations.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5035
                          gaccgttgcttggcagacactggatggttatgagc       c.-241

 .         .         .         .         .         .                g.5095
 ctgaacaagctgaaaaggggcaggaaaagaagtggaggcagcattcttcctatttaaagc       c.-181

 .         .         .         .         .         .                g.5155
 tgcatcgcttgaaaaaagttttcgcagactgtgctggagctggtgctgaaaaagggggtt       c.-121

 .         .         .         .         .         .                g.5215
 tgcagaggctgccctggggctggtgctgaaagaagagcccacagctgacttcatggtgct       c.-61

 .         .         .         .         .         .                g.5275
 acaataacctcagaatctacttttcactctcaggagaacccacatgtctaatatttagac       c.-1

          .         .         .         .         .         .       g.5335
 ATGATGGCAAACTGGGCGGAAGCAAGACCTCTCCTCATTCTTATTGTTTTATTAGGGCAA       c.60
 M  M  A  N  W  A  E  A  R  P  L  L  I  L  I  V  L  L  G  Q         p.20

          .         .         .        | 02.         .         .    g.74453
 TTTGTCTCAATAAAAGCCCAGGAAGAAGACGAGGATG | AAGGATATGGTGAAGAAATAGCC    c.120
 F  V  S  I  K  A  Q  E  E  D  E  D  E |   G  Y  G  E  E  I  A      p.40

          .         .         .         .         .         .       g.74513
 TGCACTCAGAATGGCCAGATGTACTTAAACAGGGACATTTGGAAACCTGCCCCTTGTCAG       c.180
 C  T  Q  N  G  Q  M  Y  L  N  R  D  I  W  K  P  A  P  C  Q         p.60

          .         .         .         .         .         .       g.74573
 ATCTGTGTCTGTGACAATGGAGCCATTCTCTGTGACAAGATAGAATGCCAGGATGTGCTG       c.240
 I  C  V  C  D  N  G  A  I  L  C  D  K  I  E  C  Q  D  V  L         p.80

          .         .         .         .         .         .       g.74633
 GACTGTGCCGACCCTGTAACGCCCCCTGGGGAATGCTGTCCTGTCTGTTCACAAACACCT       c.300
 D  C  A  D  P  V  T  P  P  G  E  C  C  P  V  C  S  Q  T  P         p.100

          .         .   | 03     .       | 04 .         .         . g.84764
 GGAGGTGGCAATACAAATTTTG | GTAGAGGAAGAAAG | GGACAAAAGGGAGAACCAGGATTA c.360
 G  G  G  N  T  N  F  G |   R  G  R  K   | G  Q  K  G  E  P  G  L   p.120

           | 05        .         .         .   | 06     .         . g.87567
 GTGCCTGTT | GTAACAGGCATACGTGGTCGTCCAGGACCGGCA | GGACCTCCAGGATCACAG c.420
 V  P  V   | V  T  G  I  R  G  R  P  G  P  A   | G  P  P  G  S  Q   p.140

          .         .         .       | 07 .         .         .    g.92483
 GGACCAAGAGGAGAGCGAGGGCCAAAAGGAAGACCT | GGCCCTCGTGGACCTCAGGGAATT    c.480
 G  P  R  G  E  R  G  P  K  G  R  P   | G  P  R  G  P  Q  G  I      p.160

          .         .         .         .         .         .       g.92543
 GATGGAGAACCAGGTGTTCCTGGTCAACCTGGTGCTCCAGGACCTCCTGGACATCCGTCC       c.540
 D  G  E  P  G  V  P  G  Q  P  G  A  P  G  P  P  G  H  P  S         p.180

          .         .        | 08.         .         .         .    g.96140
 CACCCAGGACCCGATGGCTTGAGCAGG | CCGTTTTCAGCTCAAATGGCTGGGTTGGATGAA    c.600
 H  P  G  P  D  G  L  S  R   | P  F  S  A  Q  M  A  G  L  D  E      p.200

          .         .         .         .      | 09  .         .    g.98124
 AAATCTGGACTTGGGAGTCAAGTAGGACTAATGCCTGGCTCTGTG | GGTCCTGTTGGCCCA    c.660
 K  S  G  L  G  S  Q  V  G  L  M  P  G  S  V   | G  P  V  G  P      p.220

          .         .         . | 10       .         .         .    g.99137
 AGGGGACCACAGGGTTTACAAGGACAGCAA | GGTGGTGCAGGACCTACAGGACCTCCTGGT    c.720
 R  G  P  Q  G  L  Q  G  Q  Q   | G  G  A  G  P  T  G  P  P  G      p.240

          .         .     | 11   .         .         .         .    g.99702
 GAACCTGGTGATCCTGGACCAATG | GGTCCGATTGGTTCACGTGGACCAGAGGGCCCTCCT    c.780
 E  P  G  D  P  G  P  M   | G  P  I  G  S  R  G  P  E  G  P  P      p.260

          .         | 12         .         .         .         .    g.100884
 GGTAAACCTGGGGAAGAT | GGTGAACCTGGCAGAAATGGAAATCCTGGTGAAGTGGGATTT    c.840
 G  K  P  G  E  D   | G  E  P  G  R  N  G  N  P  G  E  V  G  F      p.280

          .   | 13     .         .         .         .         .    g.103884
 GCAGGATCTCCG | GGAGCTCGTGGATTTCCTGGGGCTCCTGGTCTTCCAGGTCTGAAGGGT    c.900
 A  G  S  P   | G  A  R  G  F  P  G  A  P  G  L  P  G  L  K  G      p.300

        | 14 .         .         .         .         .         .    g.104902
 CACCGA | GGACACAAAGGTCTTGAAGGCCCTAAAGGTGAAGTTGGAGCACCTGGTTCCAAG    c.960
 H  R   | G  H  K  G  L  E  G  P  K  G  E  V  G  A  P  G  S  K      p.320

  | 15       .         .         .         .      | 16  .         . g.106325
  | GGTGAAGCTGGCCCCACTGGTCCAATGGGTGCCATGGGTCCTCTG | GGTCCGAGGGGAATG c.1020
  | G  E  A  G  P  T  G  P  M  G  A  M  G  P  L   | G  P  R  G  M   p.340

          .         .         .          | 17        .         .    g.109463
 CCAGGAGAGAGAGGGAGACTTGGGCCACAGGGTGCTCCT | GGACAACGAGGTGCACATGGT    c.1080
 P  G  E  R  G  R  L  G  P  Q  G  A  P   | G  Q  R  G  A  H  G      p.360

          .         .     | 18   .         .         .         .    g.112822
 ATGCCTGGAAAACCTGGACCAATG | GGTCCTCTTGGGATACCAGGCTCTTCTGGTTTTCCA    c.1140
 M  P  G  K  P  G  P  M   | G  P  L  G  I  P  G  S  S  G  F  P      p.380

          .         | 19         .         .         .         .    g.116037
 GGAAATCCTGGAATGAAG | GGAGAAGCAGGTCCTACAGGGGCGCGAGGCCCTGAAGGTCCT    c.1200
 G  N  P  G  M  K   | G  E  A  G  P  T  G  A  R  G  P  E  G  P      p.400

          .         .         .         .         .        | 20.    g.116612
 CAGGGGCAGAGAGGTGAAACTGGGCCCCCAGGTCCAGTTGGCTCTCCAGGTCTTCCT | GGT    c.1260
 Q  G  Q  R  G  E  T  G  P  P  G  P  V  G  S  P  G  L  P   | G      p.420

          .         .         .         .   | 21     .         .    g.116784
 GCAATAGGAACTGATGGTACTCCTGGTGCCAAAGGCCCAACG | GGCTCTCCGGGTACCTCT    c.1320
 A  I  G  T  D  G  T  P  G  A  K  G  P  T   | G  S  P  G  T  S      p.440

          .         .         .         .         .         .       g.116844
 GGTCCTCCTGGCTCAGCAGGGCCTCCTGGATCTCCAGGACCTCAGGGTAGCACTGGTCCT       c.1380
 G  P  P  G  S  A  G  P  P  G  S  P  G  P  Q  G  S  T  G  P         p.460

          .         .  | 22      .         .         .         .    g.118136
 CAGGGAATTCGAGGCCAACCG | GGTGATCCAGGAGTTCCAGGTTTCAAAGGAGAAGCTGGC    c.1440
 Q  G  I  R  G  Q  P   | G  D  P  G  V  P  G  F  K  G  E  A  G      p.480

          .      | 23  .         .         .         .         .    g.118427
 CCAAAAGGGGAACCA | GGGCCACATGGTATTCAGGGTCCGATAGGCCCACCCGGTGAAGAA    c.1500
 P  K  G  E  P   | G  P  H  G  I  Q  G  P  I  G  P  P  G  E  E      p.500

          .         .         .         .         .         .       g.118487
 GGCAAAAGAGGTCCCAGAGGTGACCCAGGAACAGTTGGTCCTCCAGGGCCAGTGGGAGAA       c.1560
 G  K  R  G  P  R  G  D  P  G  T  V  G  P  P  G  P  V  G  E         p.520

     | 24    .         .         .         .         .        | 25. g.120227
 AGG | GGTGCTCCTGGCAATCGTGGTTTTCCAGGCTCTGATGGTTTACCTGGGCCAAAG | GGT c.1620
 R   | G  A  P  G  N  R  G  F  P  G  S  D  G  L  P  G  P  K   | G   p.540

          .         .         .         .         .         .       g.120287
 GCTCAAGGAGAACGGGGTCCTGTAGGTTCTTCAGGACCCAAAGGAAGCCAGGGGGATCCA       c.1680
 A  Q  G  E  R  G  P  V  G  S  S  G  P  K  G  S  Q  G  D  P         p.560

          .         .         .       | 26 .         .         .    g.120870
 GGACGTCCAGGGGAACCTGGGCTTCCAGGTGCTCGG | GGTTTGACAGGAAATCCTGGTGTT    c.1740
 G  R  P  G  E  P  G  L  P  G  A  R   | G  L  T  G  N  P  G  V      p.580

          .         .         . | 27       .         .         .    g.121639
 CAAGGTCCTGAAGGAAAACTTGGACCTTTG | GGTGCGCCAGGGGAAGATGGCCGTCCAGGT    c.1800
 Q  G  P  E  G  K  L  G  P  L   | G  A  P  G  E  D  G  R  P  G      p.600

          .         .         .         .         .         .       g.121699
 CCTCCAGGCTCCATAGGAATCAGAGGGCAGCCCGGGAGCATGGGCCTTCCAGGCCCCAAA       c.1860
 P  P  G  S  I  G  I  R  G  Q  P  G  S  M  G  L  P  G  P  K         p.620

           | 28        .         .         .         .         .    g.121867
 GGTAGCAGT | GGTGACCCTGGGAAACCTGGAGAAGCAGGAAATGCTGGAGTTCCTGGGCAG    c.1920
 G  S  S   | G  D  P  G  K  P  G  E  A  G  N  A  G  V  P  G  Q      p.640

     | 29    .         .         .         .         .        | 30. g.123267
 AGG | GGAGCTCCTGGAAAAGATGGTGAAGTTGGTCCTTCTGGTCCTGTGGGCCCGCCG | GGT c.1980
 R   | G  A  P  G  K  D  G  E  V  G  P  S  G  P  V  G  P  P   | G   p.660

          .         .         .         .         .  | 31      .    g.124105
 CTAGCTGGTGAAAGAGGAGAACAAGGACCTCCAGGCCCCACAGGTTTTCAG | GGGCTTCCT    c.2040
 L  A  G  E  R  G  E  Q  G  P  P  G  P  T  G  F  Q   | G  L  P      p.680

          .         .         .         .      | 32  .         .    g.126001
 GGTCCTCCAGGGCCTCCTGGAGAAGGTGGAAAACCAGGTGATCAA | GGTGTTCCTGGAGAT    c.2100
 G  P  P  G  P  P  G  E  G  G  K  P  G  D  Q   | G  V  P  G  D      p.700

          .         .         . | 33       .         .         .    g.126382
 CCCGGAGCAGTTGGCCCGTTAGGACCTAGA | GGAGAACGAGGAAATCCTGGGGAAAGAGGA    c.2160
 P  G  A  V  G  P  L  G  P  R   | G  E  R  G  N  P  G  E  R  G      p.720

          .         .         .         .         .         .       g.126442
 GAACCTGGGATAACTGGACTCCCTGGTGAGAAGGGAATGGCTGGAGGACATGGTCCTGAT       c.2220
 E  P  G  I  T  G  L  P  G  E  K  G  M  A  G  G  H  G  P  D         p.740

           | 34        .         .         .         .         .    g.127503
 GGCCCAAAA | GGCAGTCCAGGTCCATCTGGGACCCCTGGAGATACAGGCCCACCAGGTCTT    c.2280
 G  P  K   | G  S  P  G  P  S  G  T  P  G  D  T  G  P  P  G  L      p.760

          .         .         .         .         .        | 35.    g.127856
 CAAGGTATGCCGGGAGAAAGAGGAATTGCAGGAACTCCTGGCCCCAAGGGTGACAGA | GGT    c.2340
 Q  G  M  P  G  E  R  G  I  A  G  T  P  G  P  K  G  D  R   | G      p.780

          .         .         .         .         .  | 36      .    g.130676
 GGCATAGGAGAAAAAGGTGCTGAAGGCACAGCTGGAAATGATGGTGCAAGA | GGTCTTCCA    c.2400
 G  I  G  E  K  G  A  E  G  T  A  G  N  D  G  A  R   | G  L  P      p.800

          .         .         .         .      | 37  .         .    g.130946
 GGTCCTTTGGGCCCTCCAGGTCCGGCAGGTCCTACTGGAGAAAAG | GGTGAACCTGGTCCT    c.2460
 G  P  L  G  P  P  G  P  A  G  P  T  G  E  K   | G  E  P  G  P      p.820

          .         .         .          | 38        .         .    g.131423
 CGAGGTTTAGTTGGCCCTCCTGGCTCCCGGGGCAATCCT | GGTTCTCGAGGTGAAAATGGG    c.2520
 R  G  L  V  G  P  P  G  S  R  G  N  P   | G  S  R  G  E  N  G      p.840

          .         .         .    | 39    .         .         .    g.131888
 CCAACTGGAGCTGTTGGTTTTGCCGGACCCCAG | GGTCCTGACGGACAGCCTGGAGTAAAA    c.2580
 P  T  G  A  V  G  F  A  G  P  Q   | G  P  D  G  Q  P  G  V  K      p.860

          .         .         .         .         .         .       g.131948
 GGTGAACCTGGAGAGCCAGGACAGAAGGGAGATGCTGGTTCTCCTGGACCACAAGGTTTA       c.2640
 G  E  P  G  E  P  G  Q  K  G  D  A  G  S  P  G  P  Q  G  L         p.880

          .         .  | 40      .         .         .         .    g.132116
 GCAGGATCCCCTGGCCCTCAT | GGTCCTAATGGTGTTCCTGGACTAAAAGGTGGTCGAGGA    c.2700
 A  G  S  P  G  P  H   | G  P  N  G  V  P  G  L  K  G  G  R  G      p.900

          .      | 41  .         .         .         .         .    g.132699
 ACCCAAGGTCCGCCT | GGTGCTACAGGATTTCCTGGTTCTGCGGGCAGAGTTGGACCTCCA    c.2760
 T  Q  G  P  P   | G  A  T  G  F  P  G  S  A  G  R  V  G  P  P      p.920

           | 42        .         .         .         .         .    g.133449
 GGCCCTGCT | GGAGCTCCAGGACCTGCGGGACCCCTAGGGGAACCCGGGAAGGAGGGACCT    c.2820
 G  P  A   | G  A  P  G  P  A  G  P  L  G  E  P  G  K  E  G  P      p.940

          .         .         .         .         .         .       g.133509
 CCAGGTCTTCGTGGGGACCCTGGCTCTCATGGGCGTGTGGGAGATCGAGGACCAGCTGGC       c.2880
 P  G  L  R  G  D  P  G  S  H  G  R  V  G  D  R  G  P  A  G         p.960

          .         .         .         .         .  | 43      .    g.134212
 CCCCCTGGTGGCCCAGGAGACAAAGGGGACCCAGGAGAAGATGGGCAACCT | GGTCCAGAT    c.2940
 P  P  G  G  P  G  D  K  G  D  P  G  E  D  G  Q  P   | G  P  D      p.980

          .         .         .         .         .         .       g.134272
 GGCCCCCCTGGTCCAGCTGGAACGACCGGGCAGAGAGGAATTGTTGGCATGCCTGGGCAA       c.3000
 G  P  P  G  P  A  G  T  T  G  Q  R  G  I  V  G  M  P  G  Q         p.1000

          .         .         .          | 44        .         .    g.135446
 CGTGGAGAGAGAGGCATGCCCGGCCTACCAGGCCCAGCG | GGAACACCAGGAAAAGTAGGA    c.3060
 R  G  E  R  G  M  P  G  L  P  G  P  A   | G  T  P  G  K  V  G      p.1020

          .         .         .         .         .         .       g.135506
 CCAACTGGTGCAACAGGAGATAAAGGTCCACCTGGACCTGTGGGGCCCCCAGGCTCCAAT       c.3120
 P  T  G  A  T  G  D  K  G  P  P  G  P  V  G  P  P  G  S  N         p.1040

          .         .        | 45.         .         .         .    g.136650
 GGTCCTGTAGGGGAACCTGGACCAGAA | GGTCCAGCTGGCAATGATGGTACCCCAGGACGG    c.3180
 G  P  V  G  E  P  G  P  E   | G  P  A  G  N  D  G  T  P  G  R      p.1060

          .         .  | 46      .         .         .         .    g.139011
 GATGGTGCTGTTGGAGAACGT | GGTGATCGTGGAGACCCTGGGCCTGCAGGTCTGCCAGGC    c.3240
 D  G  A  V  G  E  R   | G  D  R  G  D  P  G  P  A  G  L  P  G      p.1080

          .         .         .         .         .         .       g.139071
 TCTCAGGGTGCCCCTGGAACTCCTGGCCCTGTGGGTGCTCCAGGAGATGCAGGACAAAGA       c.3300
 S  Q  G  A  P  G  T  P  G  P  V  G  A  P  G  D  A  G  Q  R         p.1100

           | 47        .         .         .         .         .    g.139698
 GGAGATCCG | GGTTCTCGGGGTCCTATAGGACCACCTGGTCGAGCTGGGAAACGTGGATTA    c.3360
 G  D  P   | G  S  R  G  P  I  G  P  P  G  R  A  G  K  R  G  L      p.1120

     | 48    .         .         .         .         .         .    g.141678
 CCT | GGACCCCAAGGACCTCGTGGTGACAAAGGTGATCATGGAGACCGAGGCGACAGAGGT    c.3420
 P   | G  P  Q  G  P  R  G  D  K  G  D  H  G  D  R  G  D  R  G      p.1140

          .         .         .         .         .  | 49      .    g.142115
 CAGAAGGGCCACAGAGGCTTTACTGGTCTTCAGGGTCTTCCTGGCCCTCCT | GGTCCAAAT    c.3480
 Q  K  G  H  R  G  F  T  G  L  Q  G  L  P  G  P  P   | G  P  N      p.1160

          .         .         .         .      | 50  .         .    g.143201
 GGTGAACAAGGAAGTGCTGGAATCCCTGGACCATTTGGCCCAAGA | GGTCCTCCAGGCCCA    c.3540
 G  E  Q  G  S  A  G  I  P  G  P  F  G  P  R   | G  P  P  G  P      p.1180

          .         .         .         .         .         .       g.143261
 GTTGGTCCTTCAGGTAAAGAAGGAAACCCTGGGCCACTTGGGCCAATTGGACCTCCAGGT       c.3600
 V  G  P  S  G  K  E  G  N  P  G  P  L  G  P  I  G  P  P  G         p.1200

          .         .         .    | 51    .         .         .    g.145343
 GTACGAGGCAGTGTAGGAGAAGCAGGACCTGAG | GGCCCTCCTGGTGAGCCTGGCCCACCT    c.3660
 V  R  G  S  V  G  E  A  G  P  E   | G  P  P  G  E  P  G  P  P      p.1220

          .         .         .         .         .         .       g.145403
 GGCCCTCCGGGTCCCCCTGGCCACCTTACAGCTGCTCTTGGGGATATCATGGGGCACTAT       c.3720
 G  P  P  G  P  P  G  H  L  T  A  A  L  G  D  I  M  G  H  Y         p.1240

          .         .         .         .         .         .       g.145463
 GATGAAAGCATGCCAGATCCACTTCCTGAGTTTACTGAAGATCAGGCGGCTCCTGATGAC       c.3780
 D  E  S  M  P  D  P  L  P  E  F  T  E  D  Q  A  A  P  D  D         p.1260

          .         .         .         .         .         .       g.145523
 AAAAACAAAACGGACCCAGGGGTTCATGCTACCCTGAAGTCACTCAGTAGTCAGATTGAA       c.3840
 K  N  K  T  D  P  G  V  H  A  T  L  K  S  L  S  S  Q  I  E         p.1280

          .         .         .         .         .         .       g.145583
 ACCATGCGCAGCCCCGATGGCTCGAAAAAGCACCCAGCCCGCACGTGTGATGACCTAAAG       c.3900
 T  M  R  S  P  D  G  S  K  K  H  P  A  R  T  C  D  D  L  K         p.1300

          .         .      | 52  .         .         .         .    g.148111
 CTTTGCCATTCCGCAAAGCAGAGTG | GTGAATACTGGATTGATCCTAACCAAGGATCTGTT    c.3960
 L  C  H  S  A  K  Q  S  G |   E  Y  W  I  D  P  N  Q  G  S  V      p.1320

          .         .         .         .         .         .       g.148171
 GAAGATGCAATCAAAGTTTACTGCAACATGGAAACAGGAGAAACATGTATTTCAGCAAAC       c.4020
 E  D  A  I  K  V  Y  C  N  M  E  T  G  E  T  C  I  S  A  N         p.1340

          .         .         .         .         .         .       g.148231
 CCATCCAGTGTACCACGTAAAACCTGGTGGGCCAGTAAATCTCCTGACAATAAACCTGTT       c.4080
 P  S  S  V  P  R  K  T  W  W  A  S  K  S  P  D  N  K  P  V         p.1360

          .         .         .    | 53    .         .         .    g.149751
 TGGTATGGTCTTGATATGAACAGAGGGTCTCAG | TTCGCTTATGGAGACCACCAATCACCT    c.4140
 W  Y  G  L  D  M  N  R  G  S  Q   | F  A  Y  G  D  H  Q  S  P      p.1380

          .         .         .         .         .         .       g.149811
 AATACAGCCATTACTCAGATGACTTTTTTGCGCCTTTTATCAAAAGAAGCCTCCCAGAAC       c.4200
 N  T  A  I  T  Q  M  T  F  L  R  L  L  S  K  E  A  S  Q  N         p.1400

          .         .         .         .         .         .       g.149871
 ATCACTTACATCTGTAAAAACAGTGTAGGATACATGGACGATCAAGCTAAGAACCTCAAA       c.4260
 I  T  Y  I  C  K  N  S  V  G  Y  M  D  D  Q  A  K  N  L  K         p.1420

          .         .         .         .         .         .       g.149931
 AAAGCTGTGGTTCTCAAAGGGGCAAATGACTTAGATATCAAAGCAGAGGGAAATATTAGA       c.4320
 K  A  V  V  L  K  G  A  N  D  L  D  I  K  A  E  G  N  I  R         p.1440

          .         .         .    | 54    .         .         .    g.150690
 TTCCGGTATATCGTTCTTCAAGACACTTGCTCT | AAGCGGAATGGAAATGTGGGCAAGACT    c.4380
 F  R  Y  I  V  L  Q  D  T  C  S   | K  R  N  G  N  V  G  K  T      p.1460

          .         .         .         .         .         .       g.150750
 GTCTTTGAATATAGAACACAGAATGTGGCACGCTTGCCCATCATAGATCTTGCTCCTGTG       c.4440
 V  F  E  Y  R  T  Q  N  V  A  R  L  P  I  I  D  L  A  P  V         p.1480

          .         .         .         .         .         .       g.150810
 GATGTTGGCGGCACAGACCAGGAATTCGGCGTTGAAATTGGGCCAGTTTGTTTTGTGTAA       c.4500
 D  V  G  G  T  D  Q  E  F  G  V  E  I  G  P  V  C  F  V  X         p.1499

          .         .         .         .         .         .       g.150870
 agtaagccaagacacatcgacaatgagcaccaccatcaatgaccaccgccattcacaaga       c.*60

          .         .         .         .         .         .       g.150930
 actttgactgtttgaagttgatcctgagactcttgaagtaatggctgatcctgcatcagc       c.*120

          .         .         .         .         .         .       g.150990
 attgtatatatggtcttaagtgcctggcctccttatccttcagaatatttattttactta       c.*180

          .         .         .         .         .         .       g.151050
 caatcctcaagttttaattgattttaaatatttttcaatacaacagtttaggtttaagat       c.*240

          .         .         .         .         .         .       g.151110
 gaccaatgacaatgaccacctttgcagaaagtaaactgattgaataaataaatctccgtt       c.*300

          .         .         .         .         .         .       g.151170
 ttcttcaatttatttcagtgtaatgaaaaagttgcttagtatttatgaggaaattcttct       c.*360

          .         .         .         .         .         .       g.151230
 tcctggcaggtagcttaaagagtggggtatatagagccacaacacatgtttattttgctt       c.*420

          .         .         .         .         .         .       g.151290
 ggctgcagttgaaaaatagaaattagtgcccttttgtgacctctcattccaagattgtca       c.*480

          .         .         .         .         .         .       g.151350
 attaaaaatgagtttaaaatgtttaacttgtgatcgagacctacatgcatgtcttgatat       c.*540

          .         .         .         .         .         .       g.151410
 tgtgtaactataatagagactctttaaggagaatcttaaaaaaaaaaaaacgtttctcac       c.*600

          .         .         .         .         .         .       g.151470
 tgtcttaaatagaatttttaaatagtatatattcagtggcattttggagaacaaagtgaa       c.*660

          .         .         .         .         .         .       g.151530
 tttacttcgacttcttaaatttttgtaaaagactataagtttagacatctttctcattca       c.*720

          .         .         .         .         .         .       g.151590
 aatttaaagatatctttctcctcttgatcaatctatcaatattgatagaagtcacactag       c.*780

          .         .         .         .         .         .       g.151650
 tatataccatttaatacatttacactttcttatttaagaagatattgaatgcaaaataat       c.*840

          .         .         .         .         .         .       g.151710
 tgacatatagaactttacaaacatatgtccaaggactctaaattgagactcttccacatg       c.*900

          .         .         .         .         .         .       g.151770
 tacaatctcatcatcctgaagcctataatgaagaaaaagatctagaaactgagttgtgga       c.*960

          .         .         .         .         .         .       g.151830
 gctgactctaatcaaatgtgatgattggaattagaccatttggcctttgaactttcatag       c.*1020

          .         .         .         .         .         .       g.151890
 gaaaaatgacccaacatttcttagcatgagctacctcatctctagaagctgggatggact       c.*1080

          .         .         .         .         .         .       g.151950
 tactattcttgtttatattttagatactgaaaggtgctatgcttctgttattattccaag       c.*1140

          .         .         .         .         .         .       g.152010
 actggagataggcagggctaaaaaggtattattatttttcctttaatgatggtgctaaaa       c.*1200

          .         .         .         .         .         .       g.152070
 ttcttcctataaaattccttaaaaataaagatggtttaatcactaccattgtgaaaacat       c.*1260

          .         .         .         .         .         .       g.152130
 aactgttagacttcccgtttctgaaagaaagagcatcgttccaatgcttgttcactgttc       c.*1320

          .         .         .         .         .         .       g.152190
 ctctgtcatactgtatctggaatgctttgtaatacttgcatgcttcttagaccagaacat       c.*1380

          .         .         .         .         .         .       g.152250
 gtaggtccccttgtgtctcaatactttttttttcttaattgcatttgttggctctatttt       c.*1440

          .         .         .         .         .         .       g.152310
 aatttttttcttttaaaataaacagctgggaccatcccaaaagacaagccatgcatacaa       c.*1500

          .         .         .         .         .         .       g.152370
 ctttggtcatgtatctctgcaaagcatcaaattaaatgcacgcttttgtcatgtcagtgg       c.*1560

          .         .         .         .         .         .       g.152430
 tttttgttttgtgaaattcctttgaccatattagatctatttcatttccaatagtgaaaa       c.*1620

          .         .         .         .         .         .       g.152490
 ggagatgtggtggtatactttgtttgccatttgtttaaaagatacaacggataccttcta       c.*1680

          .         .         .         .         .         .       g.152550
 tcatgtatgtactggcttataaatgaaaatctatctacaacattacccacaaaggcaaca       c.*1740

          .         .         .         .         .         .       g.152610
 tgacaccaattatcactgcctctgcccttaaaaatgtcagagtagtattattgataaaaa       c.*1800

          .         .         .         .         .         .       g.152670
 gggcaagcaatagatttttcatgactgaataaactgtaataataaaacatatgtctcaaa       c.*1860

          .         .         .         .         .         .       g.152730
 gtgtatcacatatgaatttagcctaattgttttcagtttcattctcaatatttagtttac       c.*1920

          .         .         .         .         .         .       g.152790
 aacatcattttcccctaaactggttatattttgacctgtatatcttaaatttgagtattt       c.*1980

          .         .         .         .         .         .       g.152850
 atatgcctaaatacatgtgtgagttttgtttgacttccaagtccaaactataagattata       c.*2040

          .         .         .         .         .         .       g.152910
 taagttcatatagatgaatcagaaatatgtggtaatactattaagtcacaaacactaaca       c.*2100

          .         .         .         .         .                 g.152965
 atttccaactatagaaataacagttcttatttggattttgggaatgctaccaata            c.*2155

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Collagen, type V, alpha 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.2.0-22 Build 22
©2004-2009 Leiden University Medical Center