dermatan sulfate epimerase (DSE) - coding DNA reference sequence

(used for mutation description)

(last modified March 7, 2014)


This file was created to facilitate the description of sequence variants in the DSE gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_033266.1, covering DSE transcript NM_001080976.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5014
                                               gcggacgacccacc       c.-181

 .         .         .         .         .         .                g.5074
 ttgagatgcatctagcgactgctcccagcatgtaggagcagttgtaaaatcacagccgta       c.-121

 .         .         .         .         .         .                g.5134
 acagtgcctgctctccagtgtctgaaaacaaatgtttttctggtcttcacttttttgagg       c.-61

 .       | 02 .         .         .         .         .             g.124131
 caggaag | gatctttcgaagatggtttggctgccttggagatttggagatctgatgccacg    c.-1

          .         .         .         .         .         .       g.124191
 ATGAGGACTCACACACGGGGGGCTCCCAGTGTGTTTTTCATATATTTGCTTTGCTTTGTG       c.60
 M  R  T  H  T  R  G  A  P  S  V  F  F  I  Y  L  L  C  F  V         p.20

          .         .         .         .         .         .       g.124251
 TCAGCCTACATCACCGACGAGAACCCAGAAGTTATGATTCCCTTCACCAATGCCAACTAC       c.120
 S  A  Y  I  T  D  E  N  P  E  V  M  I  P  F  T  N  A  N  Y         p.40

          .         .         .         .         .         .       g.124311
 GACAGCCATCCCATGCTGTACTTCTCCAGGGCAGAAGTGGCGGAGCTGCAGCTCAGGGCT       c.180
 D  S  H  P  M  L  Y  F  S  R  A  E  V  A  E  L  Q  L  R  A         p.60

          .         .         .         .         .         .       g.124371
 GCCAGCTCGCACGAGCACATTGCAGCCCGCCTCACGGAGGCTGTGCACACGATGCTGTCC       c.240
 A  S  S  H  E  H  I  A  A  R  L  T  E  A  V  H  T  M  L  S         p.80

          .         .         .         .         .         .       g.124431
 AGCCCCTTGGAATACCTCCCTCCCTGGGATCCCAAGGACTACAGTGCCCGCTGGAATGAA       c.300
 S  P  L  E  Y  L  P  P  W  D  P  K  D  Y  S  A  R  W  N  E         p.100

          .         .         .         .         .         .       g.124491
 ATTTTTGGAAACAACTTGGGTGCCTTGGCAATGTTCTGTGTGCTGTATCCTGAGAACATT       c.360
 I  F  G  N  N  L  G  A  L  A  M  F  C  V  L  Y  P  E  N  I         p.120

          .         .         .         .         .       | 03 .    g.151458
 GAAGCCCGAGACATGGCCAAAGACTACATGGAGAGGATGGCAGCGCAGCCTAGTTG | GTTG    c.420
 E  A  R  D  M  A  K  D  Y  M  E  R  M  A  A  Q  P  S  W  |  L      p.140

          .         .         .         .         .         .       g.151518
 GTGAAAGATGCTCCTTGGGATGAGGTCCCGCTTGCTCACTCCCTGGTTGGTTTTGCCACT       c.480
 V  K  D  A  P  W  D  E  V  P  L  A  H  S  L  V  G  F  A  T         p.160

          .         .         .         .         .         .       g.151578
 GCTTATGACTTCTTGTACAACTACCTGAGCAAGACACAACAGGAGAAGTTTCTTGAAGTG       c.540
 A  Y  D  F  L  Y  N  Y  L  S  K  T  Q  Q  E  K  F  L  E  V         p.180

          .         .         .         .         .         .       g.151638
 ATTGCCAATGCCTCAGGGTATATGTATGAAACTTCATACAGGAGAGGATGGGGATTTCAA       c.600
 I  A  N  A  S  G  Y  M  Y  E  T  S  Y  R  R  G  W  G  F  Q         p.200

          .         .         .         .         .         .       g.151698
 TACCTGCACAATCATCAGCCCACCAACTGTATGGCTTTGCTCACGGGAAGCCTAGTCCTG       c.660
 Y  L  H  N  H  Q  P  T  N  C  M  A  L  L  T  G  S  L  V  L         p.220

          . | 04       .         .         .         .         .    g.155884
 ATGAATCAAG | GATATCTTCAAGAAGCCTACTTATGGACCAAACAAGTTCTGACCATCATG    c.720
 M  N  Q  G |   Y  L  Q  E  A  Y  L  W  T  K  Q  V  L  T  I  M      p.240

          .         .         .         .         .         .       g.155944
 GAGAAATCTCTGGTCTTGCTCAGGGAGGTGACGGATGGCTCCCTCTATGAAGGAGTTGCG       c.780
 E  K  S  L  V  L  L  R  E  V  T  D  G  S  L  Y  E  G  V  A         p.260

          .         .         .         .         .         .       g.156004
 TATGGCAGCTACACCACTAGATCACTCTTCCAATACATGTTTCTCGTCCAGAGGCACTTC       c.840
 Y  G  S  Y  T  T  R  S  L  F  Q  Y  M  F  L  V  Q  R  H  F         p.280

          .         .         .         .         .         .       g.156064
 AACATCAACCACTTTGGCCATCCGTGGCTTAAACAACACTTTGCATTTATGTATAGAACC       c.900
 N  I  N  H  F  G  H  P  W  L  K  Q  H  F  A  F  M  Y  R  T         p.300

          . | 05       .         .         .         .         .    g.158273
 ATCCTGCCAG | GGTTTCAAAGGACTGTGGCTATTGCGGACTCAAATTACAACTGGTTTTAT    c.960
 I  L  P  G |   F  Q  R  T  V  A  I  A  D  S  N  Y  N  W  F  Y      p.320

          .         .         .         .         .         .       g.158333
 GGTCCAGAAAGCCAATTAGTGTTCCTTGATAAATTTGTCATGCGTAATGGCAGTGGTAAC       c.1020
 G  P  E  S  Q  L  V  F  L  D  K  F  V  M  R  N  G  S  G  N         p.340

          .         .         .         .         .         .       g.158393
 TGGCTAGCTGACCAAATCAGAAGGAACCGTGTGGTGGAAGGTCCAGGAACACCATCCAAA       c.1080
 W  L  A  D  Q  I  R  R  N  R  V  V  E  G  P  G  T  P  S  K         p.360

          .         .         .         | 06         .         .    g.160489
 GGGCAGCGCTGGTGCACTCTGCACACAGAATTTCTCTG | GTATGATGGCAGCTTGAAATCG    c.1140
 G  Q  R  W  C  T  L  H  T  E  F  L  W  |  Y  D  G  S  L  K  S      p.380

          .         .         .         .         .         .       g.160549
 GTTCCTCCTCCAGACTTTGGCACCCCTACACTGCATTATTTTGAAGACTGGGGTGTCGTG       c.1200
 V  P  P  P  D  F  G  T  P  T  L  H  Y  F  E  D  W  G  V  V         p.400

          .         .         .         .         .         .       g.160609
 ACTTATGGAAGTGCACTACCTGCAGAAATCAATAGATCTTTCCTTTCCTTCAAGTCTGGA       c.1260
 T  Y  G  S  A  L  P  A  E  I  N  R  S  F  L  S  F  K  S  G         p.420

          .         .         .         .         .         .       g.160669
 AAACTGGGGGGACGTGCAATATATGACATTGTCCACAGAAACAAATACAAAGATTGGATC       c.1320
 K  L  G  G  R  A  I  Y  D  I  V  H  R  N  K  Y  K  D  W  I         p.440

          .         .         .         .         .         .       g.160729
 AAAGGATGGAGAAATTTTAATGCAGGGCATGAACATCCTGATCAAAACTCATTTACTTTT       c.1380
 K  G  W  R  N  F  N  A  G  H  E  H  P  D  Q  N  S  F  T  F         p.460

          .         .         .         .         .         .       g.160789
 GCTCCCAATGGTGTGCCTTTCATTACTGAGGCTCTGTACGGGCCAAAGTACACCTTCTTC       c.1440
 A  P  N  G  V  P  F  I  T  E  A  L  Y  G  P  K  Y  T  F  F         p.480

          .         .         .         .         .         .       g.160849
 AACAATGTTTTGATGTTTTCCCCAGCTGTGTCAAAGAGCTGCTTTTCTCCCTGGGTGGGT       c.1500
 N  N  V  L  M  F  S  P  A  V  S  K  S  C  F  S  P  W  V  G         p.500

          .         .         .         .         .         .       g.160909
 CAGGTCACAGAAGACTGCTCATCAAAATGGTCTAAATACAAGCATGACCTGGCAGCTAGT       c.1560
 Q  V  T  E  D  C  S  S  K  W  S  K  Y  K  H  D  L  A  A  S         p.520

          .         .         .         .         .         .       g.160969
 TGTCAGGGGAGGGTGGTTGCAGCAGAGGAGAAAAATGGGGTGGTTTTCATCCGAGGAGAA       c.1620
 C  Q  G  R  V  V  A  A  E  E  K  N  G  V  V  F  I  R  G  E         p.540

          .         .         .         .         .         .       g.161029
 GGTGTGGGAGCTTATAACCCCCAGCTCAACCTGAAGAATGTTCAGAGGAATCTCATCCTC       c.1680
 G  V  G  A  Y  N  P  Q  L  N  L  K  N  V  Q  R  N  L  I  L         p.560

          .         .         .         .         .         .       g.161089
 CTACATCCACAGCTGCTTCTCCTTGTAGACCAAATACACCTGGGAGAGGAGAGTCCCTTG       c.1740
 L  H  P  Q  L  L  L  L  V  D  Q  I  H  L  G  E  E  S  P  L         p.580

          .         .         .         .         .         .       g.161149
 GAGACAGCAGCGAGCTTCTTCCATAATGTGGATGTTCCTTTTGAGGAGACTGTGGTAGAT       c.1800
 E  T  A  A  S  F  F  H  N  V  D  V  P  F  E  E  T  V  V  D         p.600

          .         .         .         .         .         .       g.161209
 GGTGTCCATGGGGCTTTCATCAGGCAGAGAGATGGTCTCTATAAAATGTACTGGATGGAC       c.1860
 G  V  H  G  A  F  I  R  Q  R  D  G  L  Y  K  M  Y  W  M  D         p.620

          .         .         .         .         .         .       g.161269
 GATACTGGCTACAGCGAGAAAGCAACCTTTGCCTCAGTGACATATCCTCGGGGCTATCCC       c.1920
 D  T  G  Y  S  E  K  A  T  F  A  S  V  T  Y  P  R  G  Y  P         p.640

          .         .         .         .         .         .       g.161329
 TACAACGGGACAAACTATGTGAATGTCACCATGCACCTCCGAAGTCCCATCACCAGGGCA       c.1980
 Y  N  G  T  N  Y  V  N  V  T  M  H  L  R  S  P  I  T  R  A         p.660

          .         .         .         .         .         .       g.161389
 GCTTACCTCTTCATAGGGCCATCTATAGATGTTCAGAGCTTCACTGTCCACGGAGACTCT       c.2040
 A  Y  L  F  I  G  P  S  I  D  V  Q  S  F  T  V  H  G  D  S         p.680

          .         .         .         .         .         .       g.161449
 CAGCAACTGGATGTGTTCATAGCCACCAGCAAACATGCCTACGCCACATACCTGTGGACA       c.2100
 Q  Q  L  D  V  F  I  A  T  S  K  H  A  Y  A  T  Y  L  W  T         p.700

          .         .         .         .         .         .       g.161509
 GGTGAGGCCACAGGACAGTCTGCCTTTGCACAGGTCATTGCTGATCGTCACAAAATTCTG       c.2160
 G  E  A  T  G  Q  S  A  F  A  Q  V  I  A  D  R  H  K  I  L         p.720

          .         .         .         .         .         .       g.161569
 TTTGACCGGAATTCAGCCATCAAGAGCAGCATTGTCCCTGAGGTGAAGGACTATGCTGCT       c.2220
 F  D  R  N  S  A  I  K  S  S  I  V  P  E  V  K  D  Y  A  A         p.740

          .         .         .         .         .         .       g.161629
 ATTGTGGAACAGAACTTGCAGCATTTTAAACCAGTGTTTCAGCTGCTGGAGAAGCAGATA       c.2280
 I  V  E  Q  N  L  Q  H  F  K  P  V  F  Q  L  L  E  K  Q  I         p.760

          .         .         .         .         .         .       g.161689
 CTGTCCCGAGTCCGGAACACAGCTAGCTTTAGGAAGACTGCTGAACGCCTGCTGAGATTT       c.2340
 L  S  R  V  R  N  T  A  S  F  R  K  T  A  E  R  L  L  R  F         p.780

          .         .         .         .         .         .       g.161749
 TCAGATAAGAGACAGACTGAGGAGGCCATTGACAGGATTTTTGCCATATCACAGCAACAG       c.2400
 S  D  K  R  Q  T  E  E  A  I  D  R  I  F  A  I  S  Q  Q  Q         p.800

          .         .         .         .         .         .       g.161809
 CAGCAGCAAAGCAAGTCAAAGAAAAACCGAAGGGCAGGCAAACGCTATAAATTTGTGGAT       c.2460
 Q  Q  Q  S  K  S  K  K  N  R  R  A  G  K  R  Y  K  F  V  D         p.820

          .         .         .         .         .         .       g.161869
 GCTGTCCCTGATATTTTTGCACAGATTGAAGTCAATGAGAAAAAGATTAGACAGAAAGCT       c.2520
 A  V  P  D  I  F  A  Q  I  E  V  N  E  K  K  I  R  Q  K  A         p.840

          .         .         .         .         .         .       g.161929
 CAGATTTTGGCACAGAAAGAACTACCCATAGATGAAGATGAAGAAATGAAAGACCTTTTA       c.2580
 Q  I  L  A  Q  K  E  L  P  I  D  E  D  E  E  M  K  D  L  L         p.860

          .         .         .         .         .         .       g.161989
 GATTTTGCAGATGTAACATACGAGAAACATAAAAATGGGGGCTTGATTAAAGGCCGGTTT       c.2640
 D  F  A  D  V  T  Y  E  K  H  K  N  G  G  L  I  K  G  R  F         p.880

          .         .         .         .         .         .       g.162049
 GGACAGGCACGGATGGTGACAACTACACACAGCAGGGCCCCATCACTGTCTGCTTCCTAT       c.2700
 G  Q  A  R  M  V  T  T  T  H  S  R  A  P  S  L  S  A  S  Y         p.900

          .         .         .         .         .         .       g.162109
 ACCAGGTTGTTCCTGATTCTGAACATTGCTATTTTCTTTGTCATGTTGGCAATGCAACTG       c.2760
 T  R  L  F  L  I  L  N  I  A  I  F  F  V  M  L  A  M  Q  L         p.920

          .         .         .         .         .         .       g.162169
 ACTTATTTCCAGAGGGCCCAGAGCCTACATGGCCAAAGATGTCTTTATGCAGTTCTTCTC       c.2820
 T  Y  F  Q  R  A  Q  S  L  H  G  Q  R  C  L  Y  A  V  L  L         p.940

          .         .         .         .         .                 g.162226
 ATAGATAGCTGTATTTTATTATGGTTGTACTCTTCTTGTTCCCAATCACAGTGTTAG          c.2877
 I  D  S  C  I  L  L  W  L  Y  S  S  C  S  Q  S  Q  C  X            p.958

          .         .         .         .         .         .       g.162286
 cactgaagctataaattacctggtcattttgtgatcacaagagtctatgcaaaaaaaaaa       c.*60

          .         .         .         .         .         .       g.162346
 atttctttaccccagattatcagatttttttccctcagattcattttaacaaattaaggg       c.*120

          .         .         .         .         .         .       g.162406
 aagatattttgacacaagaaagcaggaacgtggagaaattggagcaggaaaagaaattat       c.*180

          .         .         .         .         .         .       g.162466
 caaagcaatagaaatagcttggtggtcctatggtgtttttggaagtatttggcattgcta       c.*240

          .         .         .         .         .         .       g.162526
 attgagcagtccatatagtactacttttagaagaaacaaaaagtctattttttaaagtaa       c.*300

          .         .         .         .         .         .       g.162586
 tgttttttcttatgagaaaaaggtttagatagaattgggttttattaatattaatttaat       c.*360

          .         .         .         .         .         .       g.162646
 gctattagcaatttccatatactatattgtggaaaagactgaagaatacaattctgagaa       c.*420

          .         .         .         .         .         .       g.162706
 atataaaaaaattttaatggtatactcatgttgaaagataaatgttgctaagtcctggta       c.*480

          .         .         .         .         .         .       g.162766
 tgatggtgtgagcttccttggggaagtacttcttgagttatgtaactaacaggatgtttt       c.*540

          .         .         .         .         .         .       g.162826
 actacagatctggatggctattcagataacatggcaaaaaatgatagcagaagatcatta       c.*600

          .         .         .         .         .         .       g.162886
 aaaacttaaaatatattttattagaaaacatttatctatgaatgaatatttccttgatgc       c.*660

          .         .         .         .         .         .       g.162946
 tggtctctgcacacatatgcttggttacttgcatgcattcattggttgttcaataagtga       c.*720

          .         .         .         .         .         .       g.163006
 gatgattacagataatactgtattttccttatatggaaaaccgttatagacccaataaca       c.*780

          .         .         .         .         .         .       g.163066
 actaaacctttcaaaagaaaatattttctattatgaatgttgattttcataccaaagaag       c.*840

          .         .         .         .         .         .       g.163126
 atggagagtctaaaatttggatatgattcttatgtttttttaatagaaaaccttcttcaa       c.*900

          .         .         .                                     g.163160
 gtttattttcctaaataaacatcataattgtgaa                                 c.*934

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Dermatan sulfate epimerase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2014 Leiden University Medical Center