FK506 binding protein 14 (FKBP14) - coding DNA reference sequence

(used for mutation description)

(last modified October 18, 2016)


This file was created to facilitate the description of sequence variants in the FKBP14 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032173.1, covering FKBP14 transcript NM_017946.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5053
        attggcttgagagctgcctgaaggacagcaccaatagccaatgggaggctgct       c.-241

 .         .         .         .         .         .                g.5113
 attcccaggcggccgcgttataagagccagtcaggccggcatttgggcttaactctttaa       c.-181

 .         .         .         .         .         .                g.5173
 aggtaggttcgtgacccttgagaaaagagttggtggtaaatgtgccacgtcttctaagaa       c.-121

 .         .         .         .         .         .                g.5233
 gggggagtcctgaacttgtctgaagcccttgtccgtaagccttgaactacgttcttaaat       c.-61

 .         .         .         .         .         .                g.5293
 ctatgaagtcgagggacctttcgctgcttttgtagggacttctttccttgcttcagcaac       c.-1

          .         .         .         .         .         .       g.5353
 ATGAGGCTTTTCTTGTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCT       c.60
 M  R  L  F  L  W  N  A  V  L  T  L  F  V  T  S  L  I  G  A         p.20

          .         .         .         .         .         .       g.5413
 TTGATCCCTGAACCAGAAGTGAAAATTGAAGTTCTCCAGAAGCCATTCATCTGCCATCGC       c.120
 L  I  P  E  P  E  V  K  I  E  V  L  Q  K  P  F  I  C  H  R         p.40

          .         .         .         .         .         .       g.5473
 AAGACCAAAGGAGGGGATTTGATGTTGGTCCACTATGAAGGCTACTTAGAAAAGGACGGC       c.180
 K  T  K  G  G  D  L  M  L  V  H  Y  E  G  Y  L  E  K  D  G         p.60

          .        | 02.         .         .         .         .    g.9028
 TCCTTATTTCACTCCAC | TCACAAACATAACAATGGTCAGCCCATTTGGTTTACCCTGGGC    c.240
 S  L  F  H  S  T  |  H  K  H  N  N  G  Q  P  I  W  F  T  L  G      p.80

          .         .         .         .         .         .       g.9088
 ATCCTGGAGGCTCTCAAAGGTTGGGACCAGGGCTTGAAAGGAATGTGTGTAGGAGAGAAG       c.300
 I  L  E  A  L  K  G  W  D  Q  G  L  K  G  M  C  V  G  E  K         p.100

          .         .         .         .          | 03        .    g.12689
 AGAAAGCTCATCATTCCTCCTGCTCTGGGCTATGGAAAAGAAGGAAAAG | GTAAAATTCCC    c.360
 R  K  L  I  I  P  P  A  L  G  Y  G  K  E  G  K  G |   K  I  P      p.120

          .         .         .         .         .         .       g.12749
 CCAGAAAGTACACTGATATTTAATATTGATCTCCTGGAGATTCGAAATGGACCAAGATCC       c.420
 P  E  S  T  L  I  F  N  I  D  L  L  E  I  R  N  G  P  R  S         p.140

          .         .         .         .         .        | 04.    g.16911
 CATGAATCATTCCAAGAAATGGATCTTAATGATGACTGGAAACTCTCTAAAGATGAG | GTT    c.480
 H  E  S  F  Q  E  M  D  L  N  D  D  W  K  L  S  K  D  E   | V      p.160

          .         .         .         .         .         .       g.16971
 AAAGCATATTTAAAGAAGGAGTTTGAAAAACATGGTGCGGTGGTGAATGAAAGTCATCAT       c.540
 K  A  Y  L  K  K  E  F  E  K  H  G  A  V  V  N  E  S  H  H         p.180

          .         .         .         .         .         .       g.17031
 GATGCTTTGGTGGAGGATATTTTTGATAAAGAAGATGAAGACAAAGATGGGTTTATATCT       c.600
 D  A  L  V  E  D  I  F  D  K  E  D  E  D  K  D  G  F  I  S         p.200

          .         .         .                                     g.17067
 GCCAGAGAATTTACATATAAACACGATGAGTTATAG                               c.636
 A  R  E  F  T  Y  K  H  D  E  L  X                                 p.211

          .         .         .         .         .         .       g.17127
 agatacatctacccttttaatatagcactcatctttcaagagagggcagtcatctttaaa       c.*60

          .         .         .         .         .         .       g.17187
 gaacattttatttttatacaatgttctttcttgctttgttttttatttttatatattttt       c.*120

          .         .         .         .         .         .       g.17247
 tctgactcctatttaaagaaccccttaggtttctaagtacccatttctttctgataagtt       c.*180

          .         .         .         .         .         .       g.17307
 attgggaagaaaaagctaattggtctttgaatagaagacttctggacaatttttcacttt       c.*240

          .         .         .         .         .         .       g.17367
 cacagatatgaagctttgttttactttctcacttataaatttaaaatgttgcaactggga       c.*300

          .         .         .         .         .         .       g.17427
 atataccacgacatgagaccaggttatagcacaaattagcaccctatatttctgcttccc       c.*360

          .         .         .         .         .         .       g.17487
 tctattttctccaagttagaggtcaacatttgaaaagccttttgcaatagcccaaggctt       c.*420

          .         .         .         .         .         .       g.17547
 gctattttcatgttataatgaaatagtttatgtgtaactggctctgagtctctgcttgag       c.*480

          .         .         .         .         .         .       g.17607
 gaccagaggaaaatggttgttggacctgacttgttaatggctactgctttactaaggaga       c.*540

          .         .         .         .         .         .       g.17667
 tgtgcaatgctgaagttagaaacaaggttaatagccaggcatggtggctcatgcctgtaa       c.*600

          .         .         .         .         .         .       g.17727
 tcccagcactttgggaggctgaggcgggcggatcacctgaggttgggagttcgagaccag       c.*660

          .         .         .         .         .         .       g.17787
 cctgaccaacacggagaaaccctatctctactaaaaatacaaaagtagccgggcgtggtg       c.*720

          .         .         .         .         .         .       g.17847
 atgcgtgcctgtaatcccagctacccaggaaggctgaggcggcagaatcacttgaacccg       c.*780

          .         .         .         .         .         .       g.17907
 gaggcggaggttgcggtaagccgagatcacctccagcctggacactctgtctcgaaaaaa       c.*840

          .         .         .         .         .         .       g.17967
 agaaaagaaacacggttaataacatataaatatgtatgcattgagacatgctacctagga       c.*900

          .         .         .         .         .         .       g.18027
 cttaagctgatgaagcttggctcctagtgattggtggcctattatgataaataggacaaa       c.*960

          .         .         .         .         .         .       g.18087
 tcatttatgtgtgagtttctttgtaataaaatgtatcaatatgttatagatgaggtagaa       c.*1020

          .         .         .         .         .         .       g.18147
 agttatatttatattcaatatttacttcttaaggctagcggaatatccttcctggttctt       c.*1080

          .         .         .         .         .         .       g.18207
 taatgggtagtctatagtatattatactacaataacattgtatcataagataaagtagta       c.*1140

          .         .         .         .         .         .       g.18267
 aaccagtctacattttcccatttctgtctcatcaaaaactgaagttagctgggtgtggtg       c.*1200

          .         .         .         .         .         .       g.18327
 gctcatgcctgtaatcccagcactttgggggccaaggagggtggatcacttgagatcagg       c.*1260

          .         .         .         .         .         .       g.18387
 agttcaagaccagcctggccaacatggtgaaaccttgtctctactaaaaatacaaaaatt       c.*1320

          .         .         .         .         .         .       g.18447
 agccaggcgtggtggtgcacacctgtagtcccagctactcgggaggctgagacaggagat       c.*1380

          .         .         .         .         .         .       g.18507
 ttgcttgaacccgggaggcggaggttgcagtgagccaagattgtgccactgcactccagc       c.*1440

          .         .         .         .         .         .       g.18567
 ctgggtgacagagcaagactccatctcaaaaaaaaaaaaagaagcagacctacagcagct       c.*1500

          .         .         .         .         .         .       g.18627
 actattgaataaatacctatcctggattttaaaaaagaaaaaaatatatataattttatt       c.*1560

          .         .         .         .         .         .       g.18687
 ttaaattggcttttatctttaattcttttttttaaagttatcaaatcttcattttctaag       c.*1620

          .         .         .         .         .         .       g.18747
 agtagccctttatagtgtacaaaatgatattaagtgcattattatcttcgcttttcatgg       c.*1680

          .         .         .         .         .         .       g.18807
 ctctgagtcataaaacaagctggtggatctcactgtacctaatttatagacgaggaaatt       c.*1740

          .         .         .         .         .         .       g.18867
 gtcattcaaaaagattgactgttatgcccagggtcagcactaacctgcagaaccagtatt       c.*1800

          .         .         .         .         .         .       g.18927
 cagtccccaagttcagtgtcttctactgccctctactaatgaaaagtgaaaatttccctg       c.*1860

          .         .         .         .         .         .       g.18987
 gggtctaattctctcttcagtttgctgtgccgttgtttatctttgagtcttcattctctg       c.*1920

          .         .         .         .         .         .       g.19047
 aagatggctttctgcctgtttctggtacattagaattctcactatgatatagaaatggct       c.*1980

          .         .         .         .         .         .       g.19107
 tcagtttcatagcataatcttgcagttagctctgaattgcctcaaaaaccctgaacaacg       c.*2040

          .         .         .         .         .         .       g.19167
 cgaggttccagatgtgttttacttctttcattcatatttacccccatttgttgtttaaaa       c.*2100

          .         .         .         .         .         .       g.19227
 agaattatgaacaattattacatcatatgtagaccactttcactgattatatgttgacat       c.*2160

          .         .         .         .         .         .       g.19287
 tttcctcagtaaaacataaagttcttaacaagactatactgtaacacctttctccaacaa       c.*2220

          .         .         .         .         .         .       g.19347
 aatcagctgtatgttgaaaactattaagtcattgctaatgttttaagccataatacagac       c.*2280

          .         .         .         .         .         .       g.19407
 agccttatactctatgatgggagaagggaaagtagtttgtccgatggtgctactctgtat       c.*2340

          .         .         .         .         .         .       g.19467
 aaacattactgatgctatctatagtagggcaagaaaagtaaaaagagttttgattattca       c.*2400

          .         .         .         .         .         .       g.19527
 ggcagcatttttaaaaacctgtgaatttgtatcagttctcatctaaacatttggacacaa       c.*2460

          .         .         .         .         .         .       g.19587
 gtataaaatgaaaacatatgcacaagttatggtttttaagttatctgctcttttttttgg       c.*2520

          .         .         .         .         .         .       g.19647
 tttcactgtacctttgtactcttctattagtgggaataatcagacatgaactgtgacttc       c.*2580

          .         .         .         .         .         .       g.19707
 acatgtacagtcatacctcacttaatgatggagatgcactctgagaaatgtctaattagg       c.*2640

          .         .         .         .         .         .       g.19767
 ttatttcatcgttgtgggaacatcatagagtgtacttacacaaacctagatagtgtagcc       c.*2700

          .         .         .         .         .         .       g.19827
 tgctacacatgtaggacatgtatatagcctattgctcctaggctacagcatgttgctgtt       c.*2760

          .         .         .         .         .         .       g.19887
 ctgaatcatgtaggcaattgtaacacaatggcaagtgtctgtttattcaaacatctaaac       c.*2820

          .         .         .         .         .         .       g.19947
 acagaaaagatactacaacaataacaatatggtataaaagattttgtaaaaaatctggtc       c.*2880

          .         .         .         .         .         .       g.20007
 aggtgcagtggttcacgcctgtaatcctagcactttgggaggctgcctcagcaggtggat       c.*2940

          .         .         .         .         .         .       g.20067
 tgcttgagcccagaagctcaagaccagcctgggcaacatggcgaaaccccgtctctgcta       c.*3000

          .         .         .         .         .         .       g.20127
 aaagtacaaaagctgaggttggaggatcacctgagcctggcaaggtcaaggctgcagtga       c.*3060

          .         .         .         .         .         .       g.20187
 gccatgatcataccactgcactccagcctgggtgacagagtgactccccatctaaaaaaa       c.*3120

          .         .         .         .         .         .       g.20247
 aaaatatatatatatatatatactatatatatatatataccatatatatggtatatatat       c.*3180

          .         .         .         .         .         .       g.20307
 atatagtatatatatatatggtgtgtgtatatatatatatatggtatacctgtatagggc       c.*3240

          .         .         .         .         .         .       g.20367
 acttactaacggagcttacagaactggaagttgctctggatgagtcagtggtgagtgaat       c.*3300

          .         .         .         .         .         .       g.20427
 gtaaaggcctaggacattactgtacactactgtagactttataaacaccgtacacttagg       c.*3360

          .         .         .         .         .         .       g.20487
 tgacactaaaatttataaaaaatgtttttcttctggttgggcatggtgccttatgcctat       c.*3420

          .         .         .         .         .         .       g.20547
 aatcccagcattatgggaggccaaggtgggtggatcactcgaggtcatgagtttgggacc       c.*3480

          .         .         .         .         .         .       g.20607
 agccgggccaacatggctaaaccccatctctactaaaaatacgataattagccaggtgtg       c.*3540

          .         .         .         .         .         .       g.20667
 gtggcacatgcgtgtagtcccagctaattgagaggctgaggcaggagaattgcttgaatc       c.*3600

          .         .         .         .         .         .       g.20727
 caggaggtggaggttgcagtgagccaagatcgaaccactgcactctagtctgggtgacag       c.*3660

          .         .         .         .         .         .       g.20787
 aggagcaagactctgtctcaaaaaaaaaaattctataatttttatagaaataataaaaaa       c.*3720

          .         .         .         .         .         .       g.20847
 ctaaccttagcttactgtaaattttctagtttagaaacttatttaaaaacaatttttgga       c.*3780

          .         .         .         .         .         .       g.20907
 ctcttctagtaataacgtagcttaaaacacacattgcatagctgtacaaaaatattttcc       c.*3840

          .         .         .         .         .         .       g.20967
 ttatatccttattatataagcttttatctatttaaattttgaatttttaaactttttggt       c.*3900

          .         .         .         .         .         .       g.21027
 caaaaaccaagacaaacacactagcctaggcctatgcagggtcaggatcaagacatccct       c.*3960

          .         .         .         .         .         .       g.21087
 agcaggtgacaggaatttttcaactccattataatctgtggggccaccatcatatatata       c.*4020

          .         .         .         .         .         .       g.21147
 ttgtacattgaccgaaacatggttacatgactatataatttgcgtcaatactgctcagtg       c.*4080

          .         .         .         .         .         .       g.21207
 tgccatatttaaatttacatgactatattgtgatattcttttcaaaataaagtttatttg       c.*4140

          .                                                         g.21219
 ggagataactga                                                       c.*4152

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The FK506 binding protein 14 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 36
©2004-2016 Leiden University Medical Center