procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 (PLOD1) - coding DNA reference sequence

(used for mutation description)

(last modified November 8, 2010)


This file was created to facilitate the description of sequence variants in the PLOD1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008159.1, covering PLOD1 transcript NM_000302.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5031
                              agtgcgtggcagcgggacctgcggccccgtc       c.-61

 .         .         .         .         .         .                g.5091
 gcgaagtttccagccctgcgagcgccgccgggtcggccgatcgtcccccatacctcggcc       c.-1

          .         .         .         .         .         .       g.5151
 ATGCGGCCCCTGCTGCTACTGGCCCTGCTGGGCTGGCTGCTGCTGGCCGAAGCGAAGGGC       c.60
 M  R  P  L  L  L  L  A  L  L  G  W  L  L  L  A  E  A  K  G         p.20

          .       | 02 .         .         .         .         .    g.18331
 GACGCCAAGCCGGAGG | ACAACCTTTTAGTCCTCACGGTGGCCACTAAGGAGACCGAGGGA    c.120
 D  A  K  P  E  D |   N  L  L  V  L  T  V  A  T  K  E  T  E  G      p.40

          .         .         .         .         | 03         .    g.20096
 TTCCGTCGCTTCAAGCGCTCAGCTCAGTTCTTCAACTACAAGATCCAG | GCGCTTGGCCTA    c.180
 F  R  R  F  K  R  S  A  Q  F  F  N  Y  K  I  Q   | A  L  G  L      p.60

          .         .         .         .         .         .       g.20156
 GGGGAGGACTGGAATGTGGAGAAGGGGACGTCGGCAGGTGGAGGGCAGAAGGTCCGGCTG       c.240
 G  E  D  W  N  V  E  K  G  T  S  A  G  G  G  Q  K  V  R  L         p.80

          .         .         .         .         .         .       g.20216
 CTGAAGAAAGCTCTGGAGAAGCACGCAGACAAGGAGGATCTGGTCATTCTCTTCGCAGAC       c.300
 L  K  K  A  L  E  K  H  A  D  K  E  D  L  V  I  L  F  A  D         p.100

    | 04     .         .         .         .         .         .    g.20726
 AG | CTATGACGTGCTGTTTGCATCGGGGCCCCGGGAGCTCCTGAAGAAGTTCCGGCAGGCC    c.360
 S  |  Y  D  V  L  F  A  S  G  P  R  E  L  L  K  K  F  R  Q  A      p.120

          .         .         .         .         .         .       g.20786
 AGGAGCCAGGTGGTCTTCTCTGCTGAGGAGCTCATCTACCCAGACCGCAGGCTGGAGACC       c.420
 R  S  Q  V  V  F  S  A  E  E  L  I  Y  P  D  R  R  L  E  T         p.140

          .         .         .         .       | 05 .         .    g.22948
 AAGTATCCGGTGGTGTCCGATGGCAAGAGGTTCCTGGGCTCTGGAG | GCTTCATCGGTTAT    c.480
 K  Y  P  V  V  S  D  G  K  R  F  L  G  S  G  G |   F  I  G  Y      p.160

          .         .         .         .         .         .       g.23008
 GCCCCCAACCTCAGCAAACTGGTGGCCGAGTGGGAGGGCCAGGACAGCGACAGCGATCAG       c.540
 A  P  N  L  S  K  L  V  A  E  W  E  G  Q  D  S  D  S  D  Q         p.180

          .         .         .          | 06        .         .    g.25162
 CTGTTTTACACCAAGATCTTCTTGGACCCGGAGAAGAGG | GAGCAGATCAATATCACCCTG    c.600
 L  F  Y  T  K  I  F  L  D  P  E  K  R   | E  Q  I  N  I  T  L      p.200

          .         .         .         .    | 07    .         .    g.27245
 GACCACCGCTGCCGTATCTTCCAGAACCTGGATGGAGCCTTGG | ATGAGGTCGTGCTCAAG    c.660
 D  H  R  C  R  I  F  Q  N  L  D  G  A  L  D |   E  V  V  L  K      p.220

          .         .         .         .         .         .       g.27305
 TTTGAAATGGGCCATGTGAGAGCGAGGAACCTGGCCTATGACACCCTCCCGGTCCTGATC       c.720
 F  E  M  G  H  V  R  A  R  N  L  A  Y  D  T  L  P  V  L  I         p.240

          .         .  | 08      .         .         .         .    g.28192
 CATGGCAACGGGCCAACCAAG | CTGCAGTTGAACTACCTGGGCAACTACATCCCGCGCTTC    c.780
 H  G  N  G  P  T  K   | L  Q  L  N  Y  L  G  N  Y  I  P  R  F      p.260

          .         .         .         .         .         .       g.28252
 TGGACCTTCGAAACAGGCTGCACCGTGTGTGACGAAGGCTTGCGCAGCCTCAAGGGCATT       c.840
 W  T  F  E  T  G  C  T  V  C  D  E  G  L  R  S  L  K  G  I         p.280

     | 09    .         .         .         .         .         .    g.28884
 GGG | GATGAAGCTCTGCCCACGGTCCTGGTCGGCGTGTTCATCGAACAGCCCACGCCGTTT    c.900
 G   | D  E  A  L  P  T  V  L  V  G  V  F  I  E  Q  P  T  P  F      p.300

          .         .         .         .         .         .       g.28944
 GTGTCCCTGTTCTTCCAGCGGCTCCTGCGGCTCCACTACCCCCAGAAACACATGCGACTT       c.960
 V  S  L  F  F  Q  R  L  L  R  L  H  Y  P  Q  K  H  M  R  L         p.320

          .      | 10  .         .         .         .         .    g.31002
 TTCATCCACAACCAC | GAGCAGCACCACAAGGCTCAGGTGGAAGAGTTCCTGGCACAGCAT    c.1020
 F  I  H  N  H   | E  Q  H  H  K  A  Q  V  E  E  F  L  A  Q  H      p.340

          .         .         .         .         .         .       g.31062
 GGCAGCGAGTACCAGTCTGTGAAGCTGGTGGGCCCTGAGGTGCGGATGGCGAATGCAGAT       c.1080
 G  S  E  Y  Q  S  V  K  L  V  G  P  E  V  R  M  A  N  A  D         p.360

          .        | 11.         .         .         .         .    g.33886
 GCCAGGAACATGGGCGC | AGACCTGTGCCGGCAGGACCGCAGCTGCACCTACTACTTCAGC    c.1140
 A  R  N  M  G  A  |  D  L  C  R  Q  D  R  S  C  T  Y  Y  F  S      p.380

          .         .         .         .         .         .       g.33946
 GTGGATGCTGACGTGGCCCTGACCGAGCCCAACAGCCTGCGGCTGCTGATCCAACAGAAC       c.1200
 V  D  A  D  V  A  L  T  E  P  N  S  L  R  L  L  I  Q  Q  N         p.400

    | 12     .         .         .         .         .         .    g.34544
 AA | GAACGTCATTGCCCCGCTGATGACCCGGCATGGGAGGCTGTGGTCGAACTTCTGGGGG    c.1260
 K  |  N  V  I  A  P  L  M  T  R  H  G  R  L  W  S  N  F  W  G      p.420

          .         .         .         .         .         .       g.34604
 GCTCTCAGTGCAGATGGCTACTATGCCCGTTCCGAGGACTACGTGGACATTGTGCAGGGG       c.1320
 A  L  S  A  D  G  Y  Y  A  R  S  E  D  Y  V  D  I  V  Q  G         p.440

          | 13         .         .         .         .         .    g.35007
 CGGCGTGT | TGGTGTCTGGAATGTGCCCTATATTTCAAACATCTACTTGATCAAGGGCAGT    c.1380
 R  R  V  |  G  V  W  N  V  P  Y  I  S  N  I  Y  L  I  K  G  S      p.460

          .         .         .         .         .         .       g.35067
 GCCCTGCGGGGTGAGCTGCAGTCCTCAGATCTCTTCCACCACAGCAAGCTGGACCCCGAC       c.1440
 A  L  R  G  E  L  Q  S  S  D  L  F  H  H  S  K  L  D  P  D         p.480

          .         .         . | 14       .         .         .    g.35821
 ATGGCCTTCTGTGCCAACATCCGGCAGCAG | GATGTGTTCATGTTCCTGACCAACCGGCAC    c.1500
 M  A  F  C  A  N  I  R  Q  Q   | D  V  F  M  F  L  T  N  R  H      p.500

          .         .         .         .         .         .       g.35881
 ACCCTTGGCCATCTGCTCTCCCTAGACAGCTACCGCACCACCCACCTGCACAACGACCTC       c.1560
 T  L  G  H  L  L  S  L  D  S  Y  R  T  T  H  L  H  N  D  L         p.520

          .         .     | 15   .         .         .         .    g.36598
 TGGGAGGTGTTCAGCAACCCCGAG | GACTGGAAGGAGAAGTACATCCACCAGAACTACACC    c.1620
 W  E  V  F  S  N  P  E   | D  W  K  E  K  Y  I  H  Q  N  Y  T      p.540

          .         .         . | 16       .         .         .    g.37328
 AAAGCCCTGGCAGGGAAGCTGGTGGAGACG | CCCTGCCCGGATGTCTATTGGTTCCCCATC    c.1680
 K  A  L  A  G  K  L  V  E  T   | P  C  P  D  V  Y  W  F  P  I      p.560

          .         .         .         .         .         .       g.37388
 TTCACGGAGGTGGCCTGTGATGAGCTGGTGGAGGAGATGGAGCACTTTGGCCAGTGGTCT       c.1740
 F  T  E  V  A  C  D  E  L  V  E  E  M  E  H  F  G  Q  W  S         p.580

          .      | 17  .         .         .         .         .    g.41026
 CTGGGCAACAACAAG | GACAACCGCATCCAGGGTGGCTACGAGAACGTGCCGACTATTGAC    c.1800
 L  G  N  N  K   | D  N  R  I  Q  G  G  Y  E  N  V  P  T  I  D      p.600

          .         .         .         .         .         .       g.41086
 ATCCACATGAACCAGATCGGCTTTGAGCGGGAGTGGCACAAATTCCTGCTGGAGTACATT       c.1860
 I  H  M  N  Q  I  G  F  E  R  E  W  H  K  F  L  L  E  Y  I         p.620

          .         .         .         .   | 18     .         .    g.43201
 GCGCCCATGACGGAGAAGCTCTACCCCGGCTACTACACCAGG | GCCCAGTTTGACCTGGCC    c.1920
 A  P  M  T  E  K  L  Y  P  G  Y  Y  T  R   | A  Q  F  D  L  A      p.640

          .         .         .         .         .         .       g.43261
 TTTGTCGTCCGCTACAAGCCTGATGAGCAGCCCTCACTGATGCCACACCATGATGCCTCC       c.1980
 F  V  V  R  Y  K  P  D  E  Q  P  S  L  M  P  H  H  D  A  S         p.660

          .         .         .         .         | 19         .    g.44976
 ACCTTCACCATCAACATCGCCCTGAACCGAGTCGGGGTGGATTACGAG | GGCGGGGGCTGT    c.2040
 T  F  T  I  N  I  A  L  N  R  V  G  V  D  Y  E   | G  G  G  C      p.680

          .         .         .         .         .         .       g.45036
 CGGTTCCTGCGCTACAACTGTTCCATCCGAGCCCCAAGGAAGGGCTGGACCCTCATGCAC       c.2100
 R  F  L  R  Y  N  C  S  I  R  A  P  R  K  G  W  T  L  M  H         p.700

          .         .         .         .         .         .       g.45096
 CCTGGACGACTCACGCATTACCATGAGGGGCTCCCCACCACCAGGGGCACCCGCTACATC       c.2160
 P  G  R  L  T  H  Y  H  E  G  L  P  T  T  R  G  T  R  Y  I         p.720

          .         .                                               g.45120
 GCAGTCTCCTTCGTCGATCCCTAA                                           c.2184
 A  V  S  F  V  D  P  X                                             p.727

          .         .         .         .         .         .       g.45180
 ttggccaggcctgaccctcttggacctttcttctttgccgacaaccactgcccagcagcc       c.*60

          .         .         .         .         .         .       g.45240
 tctgggacctcggggtcccagggaacccagtccagcctcctggctgttgacttcccattg       c.*120

          .         .         .         .         .         .       g.45300
 ctcttggagccaccaatcaaagagattcaaagagattcctgcaggccagaggcggaacac       c.*180

          .         .         .         .         .         .       g.45360
 acctttatggctggggctctccgtggtgttctggacccagcccctggagacaccattcac       c.*240

          .         .         .         .         .         .       g.45420
 ttttactgctttgtagtgactcgtgctctccaacctgtcttcctgaaaaaccaaggcccc       c.*300

          .         .         .         .         .         .       g.45480
 cttcccccacctcttccatggggtgagacttgagcagaacaggggcttccccaagttgcc       c.*360

          .         .         .         .         .         .       g.45540
 cagaaagactgtctgggtgagaagccatggccagagcttctcccaggcacaggtgttgca       c.*420

          .         .         .         .         .         .       g.45600
 ccagggacttctgcttcaagttttggggtaaagacacctggatcagactccaagggctgc       c.*480

          .         .         .         .         .         .       g.45660
 cctgagtctgggacttctgcctccatggctggtcatgagagcaaaccgtagtcccctgga       c.*540

          .         .         .         .         .         .       g.45720
 gacagcgactccagagaacctcttgggagacagaagaggcatctgtgcacagctcgatct       c.*600

          .         .         .         .         .         .       g.45780
 tctacttgcctgtggggaggggagtgacaggtccacacaccacactgggtcaccctgtcc       c.*660

          .         .         .         .         .         .       g.45840
 tggatgcctctgaagagagggacagaccgtcagaaactggagagtttctattaaaggtca       c.*720

                                                                    g.45849
 tttaaacca                                                          c.*729

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center