procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3) - coding DNA reference sequence

(used for mutation description)

(last modified July 29, 2011)


This file was created to facilitate the description of sequence variants in the PLOD3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012148.1, covering PLOD3 transcript NM_001084.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5036
                         taggcttcctccctccctgtcgccgccagcctctcg       c.-421

 .         .         .         .         .         .                g.5096
 ctctccccgtcttccgcccgcactctctgggcagggctgcggccaggacccgcccccgcg       c.-361

 .         .         .         .         .         .                g.5156
 tcccgcccgaccctccgccaggggtcacttcccctgtccaggtttcagcttccacatgtg       c.-301

 .         .         .         .         .         .                g.5216
 tcaagcggctggctcagcccagagtccctgtctcccgcccgccggcccgagccgccgccc       c.-241

 .         .         .         .         .         .                g.5276
 ctcccccgcctcccgtgcgcccgggacaatcctcgccttgtctgtggcgccggcatctgg       c.-181

 .         .         .         .         .         .                g.5336
 agctttctgtagcctccggatacgcctttttttcagggcgtagccccagccaagctgctc       c.-121

 .         .         .         .         .         .                g.5396
 cccgcggcggccgcacagcagcccgagcgccccctttccagagctcccctccggagctgg       c.-61

 .         .         .         .         .         .                g.5456
 gatccaggcgcgtagcggagatcccaggatcctgggtgctgtctgggcccgctccccacc       c.-1

          .         .         .         .         .         .       g.5516
 ATGACCTCCTCGGGGCCTGGACCCCGGTTCCTGCTGCTGCTGCCGCTGCTGCTGCCCCCT       c.60
 M  T  S  S  G  P  G  P  R  F  L  L  L  L  P  L  L  L  P  P         p.20

          .         .         .         .          | 02        .    g.5955
 GCGGCCTCAGCCTCCGACCGGCCCCGGGGCCGAGACCCGGTCAACCCAG | AGAAGCTGCTG    c.120
 A  A  S  A  S  D  R  P  R  G  R  D  P  V  N  P  E |   K  L  L      p.40

          .         .         .         .         .         .       g.6015
 GTGATCACTGTGGCCACAGCTGAAACCGAGGGGTACCTGCGTTTCCTGCGCTCTGCGGAG       c.180
 V  I  T  V  A  T  A  E  T  E  G  Y  L  R  F  L  R  S  A  E         p.60

          .         .  | 03      .         .         .         .    g.6223
 TTCTTCAACTACACTGTGCGG | ACCCTGGGCCTGGGAGAGGAGTGGCGAGGGGGTGATGTG    c.240
 F  F  N  Y  T  V  R   | T  L  G  L  G  E  E  W  R  G  G  D  V      p.80

          .         .         .         .         .         .       g.6283
 GCTCGAACAGTTGGTGGAGGACAGAAGGTCCGGTGGTTAAAGAAGGAAATGGAGAAATAC       c.300
 A  R  T  V  G  G  G  Q  K  V  R  W  L  K  K  E  M  E  K  Y         p.100

          .         .         .         | 04         .         .    g.6426
 GCTGACCGGGAGGATATGATCATCATGTTTGTGGATAG | CTACGACGTGATTCTGGCCGGC    c.360
 A  D  R  E  D  M  I  I  M  F  V  D  S  |  Y  D  V  I  L  A  G      p.120

          .         .         .         .         .         .       g.6486
 AGCCCCACAGAGCTGCTGAAGAAGTTCGTCCAGAGTGGCAGCCGCCTGCTCTTCTCTGCA       c.420
 S  P  T  E  L  L  K  K  F  V  Q  S  G  S  R  L  L  F  S  A         p.140

          .         .         .         .         .         .       g.6546
 GAGAGCTTCTGCTGGCCCGAGTGGGGGCTGGCGGAGCAGTACCCTGAGGTGGGCACGGGG       c.480
 E  S  F  C  W  P  E  W  G  L  A  E  Q  Y  P  E  V  G  T  G         p.160

          .         .   | 05     .         .         .         .    g.6748
 AAGCGCTTCCTCAATTCTGGTG | GATTCATCGGTTTTGCCACCACCATCCACCAAATCGTG    c.540
 K  R  F  L  N  S  G  G |   F  I  G  F  A  T  T  I  H  Q  I  V      p.180

          .         .         .         .         .         .       g.6808
 CGCCAGTGGAAGTACAAGGATGATGACGACGACCAGCTGTTCTACACACGGCTCTACCTG       c.600
 R  Q  W  K  Y  K  D  D  D  D  D  Q  L  F  Y  T  R  L  Y  L         p.200

          .      | 06  .         .         .         .         .    g.7623
 GACCCAGGACTGAGG | GAGAAACTCAGCCTTAATCTGGATCATAAGTCTCGGATCTTTCAG    c.660
 D  P  G  L  R   | E  K  L  S  L  N  L  D  H  K  S  R  I  F  Q      p.220

          .          | 07        .         .         .         .    g.9567
 AACCTCAACGGGGCTTTAG | ATGAAGTGGTTTTAAAGTTTGATCGGAACCGTGTGCGTATC    c.720
 N  L  N  G  A  L  D |   E  V  V  L  K  F  D  R  N  R  V  R  I      p.240

          .         .         .         .         .        | 08.    g.9790
 CGGAACGTGGCCTACGACACGCTCCCCATTGTGGTCCATGGAAACGGTCCCACTAAG | CTG    c.780
 R  N  V  A  Y  D  T  L  P  I  V  V  H  G  N  G  P  T  K   | L      p.260

          .         .         .         .         .         .       g.9850
 CAGCTCAACTACCTGGGAAACTACGTCCCCAATGGCTGGACTCCTGAGGGAGGCTGTGGC       c.840
 Q  L  N  Y  L  G  N  Y  V  P  N  G  W  T  P  E  G  G  C  G         p.280

          .         .         .          | 09        .         .    g.10096
 TTCTGCAACCAGGACCGGAGGACACTCCCGGGGGGGCAG | CCTCCCCCCCGGGTGTTTCTG    c.900
 F  C  N  Q  D  R  R  T  L  P  G  G  Q   | P  P  P  R  V  F  L      p.300

          .         .         .         .         .         .       g.10156
 GCCGTGTTTGTGGAACAGCCTACTCCGTTTCTGCCCCGCTTCCTGCAGCGGCTGCTACTC       c.960
 A  V  F  V  E  Q  P  T  P  F  L  P  R  F  L  Q  R  L  L  L         p.320

          .         .         .         .      | 10  .         .    g.10371
 CTGGACTATCCCCCCGACAGGGTCACCCTTTTCCTGCACAACAAC | GAGGTCTTCCATGAA    c.1020
 L  D  Y  P  P  D  R  V  T  L  F  L  H  N  N   | E  V  F  H  E      p.340

          .         .         .         .         .         .       g.10431
 CCCCACATCGCTGACTCCTGGCCGCAGCTCCAGGACCACTTCTCAGCTGTGAAGCTCGTG       c.1080
 P  H  I  A  D  S  W  P  Q  L  Q  D  H  F  S  A  V  K  L  V         p.360

          .         .         .         .        | 11.         .    g.10793
 GGGCCGGAGGAGGCTCTGAGCCCAGGCGAGGCCAGGGACATGGCCAT | GGACCTGTGTCGG    c.1140
 G  P  E  E  A  L  S  P  G  E  A  R  D  M  A  M  |  D  L  C  R      p.380

          .         .         .         .         .         .       g.10853
 CAGGACCCCGAGTGTGAGTTCTACTTCAGCCTGGACGCCGACGCTGTCCTCACCAACCTG       c.1200
 Q  D  P  E  C  E  F  Y  F  S  L  D  A  D  A  V  L  T  N  L         p.400

          .         .         .   | 12     .         .         .    g.11042
 CAGACCCTGCGTATCCTCATTGAGGAGAACAG | GAAGGTGATCGCCCCCATGCTGTCCCGC    c.1260
 Q  T  L  R  I  L  I  E  E  N  R  |  K  V  I  A  P  M  L  S  R      p.420

          .         .         .         .         .         .       g.11102
 CACGGCAAGCTGTGGTCCAACTTCTGGGGCGCCCTGAGCCCCGATGAGTACTACGCCCGC       c.1320
 H  G  K  L  W  S  N  F  W  G  A  L  S  P  D  E  Y  Y  A  R         p.440

          .         .         .         | 13         .         .    g.12079
 TCCGAGGACTACGTGGAGCTGGTGCAGCGGAAGCGAGT | GGGTGTGTGGAATGTACCATAC    c.1380
 S  E  D  Y  V  E  L  V  Q  R  K  R  V  |  G  V  W  N  V  P  Y      p.460

          .         .         .         .         .         .       g.12139
 ATCTCCCAGGCCTATGTGATCCGGGGTGATACCCTGCGGATGGAGCTGCCCCAGAGGGAT       c.1440
 I  S  Q  A  Y  V  I  R  G  D  T  L  R  M  E  L  P  Q  R  D         p.480

          .         .         .         .         .         .       g.12199
 GTGTTCTCGGGCAGTGACACAGACCCGGACATGGCCTTCTGTAAGAGCTTTCGAGACAAG       c.1500
 V  F  S  G  S  D  T  D  P  D  M  A  F  C  K  S  F  R  D  K         p.500

  | 14       .         .         .         .         .         .    g.12346
  | GGCATCTTCCTCCATCTGAGCAATCAGCATGAATTTGGCCGGCTCCTGGCCACTTCCAGA    c.1560
  | G  I  F  L  H  L  S  N  Q  H  E  F  G  R  L  L  A  T  S  R      p.520

          .         .         .         .         .     | 15   .    g.12575
 TACGACACGGAGCACCTGCACCCCGACCTCTGGCAGATCTTCGACAACCCCGTC | GACTGG    c.1620
 Y  D  T  E  H  L  H  P  D  L  W  Q  I  F  D  N  P  V   | D  W      p.540

          .         .         .         .         .         .       g.12635
 AAGGAGCAGTACATCCACGAGAACTACAGCCGGGCCCTGGAAGGGGAAGGAATCGTGGAG       c.1680
 K  E  Q  Y  I  H  E  N  Y  S  R  A  L  E  G  E  G  I  V  E         p.560

     | 16    .         .         .         .         .         .    g.13830
 CAG | CCATGCCCGGACGTGTACTGGTTCCCACTGCTGTCAGAACAAATGTGTGATGAGCTG    c.1740
 Q   | P  C  P  D  V  Y  W  F  P  L  L  S  E  Q  M  C  D  E  L      p.580

          .         .         .         .         | 17         .    g.15018
 GTGGCAGAGATGGAGCACTACGGCCAGTGGTCAGGCGGCCGGCATGAG | GATTCAAGGCTG    c.1800
 V  A  E  M  E  H  Y  G  Q  W  S  G  G  R  H  E   | D  S  R  L      p.600

          .         .         .         .         .         .       g.15078
 GCTGGAGGCTACGAGAATGTGCCCACCGTGGACATCCACATGAAGCAGGTGGGGTACGAG       c.1860
 A  G  G  Y  E  N  V  P  T  V  D  I  H  M  K  Q  V  G  Y  E         p.620

          .         .         .         .         .         .       g.15138
 GACCAGTGGCTGCAGCTGCTGCGGACGTATGTGGGCCCCATGACCGAGAGCCTGTTTCCC       c.1920
 D  Q  W  L  Q  L  L  R  T  Y  V  G  P  M  T  E  S  L  F  P         p.640

          .      | 18  .         .         .         .         .    g.15871
 GGTTACCACACCAAG | GCGCGGGCGGTGATGAACTTTGTGGTTCGCTACCGGCCAGACGAG    c.1980
 G  Y  H  T  K   | A  R  A  V  M  N  F  V  V  R  Y  R  P  D  E      p.660

          .         .         .         .         .         .       g.15931
 CAGCCGTCTCTGCGGCCACACCACGACTCATCCACCTTCACCCTCAACGTTGCCCTCAAC       c.2040
 Q  P  S  L  R  P  H  H  D  S  S  T  F  T  L  N  V  A  L  N         p.680

          .         .  | 19      .         .         .         .    g.16333
 CACAAGGGCCTGGACTATGAG | GGAGGTGGCTGCCGCTTCCTGCGCTACGACTGTGTGATC    c.2100
 H  K  G  L  D  Y  E   | G  G  G  C  R  F  L  R  Y  D  C  V  I      p.700

          .         .         .         .         .         .       g.16393
 TCCTCCCCGAGGAAGGGCTGGGCACTCCTGCACCCCGGCCGCCTCACCCACTACCACGAG       c.2160
 S  S  P  R  K  G  W  A  L  L  H  P  G  R  L  T  H  Y  H  E         p.720

          .         .         .         .         .                 g.16450
 GGGCTGCCAACGACCTGGGGCACACGCTACATCATGGTGTCCTTTGTCGACCCCTGA          c.2217
 G  L  P  T  T  W  G  T  R  Y  I  M  V  S  F  V  D  P  X            p.738

          .         .         .         .         .         .       g.16510
 cactcaaccactctgccaaacctgccctgccattgtgcctttttagggggcctggccccc       c.*60

          .         .         .         .         .         .       g.16570
 gtcctgggagttgggggatgggtctctctgtctccccacttcctgagttcatgttccgcg       c.*120

          .         .         .         .         .         .       g.16630
 tgcctgaactgaatatgtcaccttgctcccaagacacggccctctcaggaagctcccgga       c.*180

          .         .         .         .         .         .       g.16690
 gtccccgcctctctcctccgcccacaggggttcgtgggcacagggcttctggggactccc       c.*240

          .         .         .         .         .         .       g.16750
 cgcgtgataaattattaatgttccgcagtctcactctgaataaaggacagtttgtaagtc       c.*300

                                                                    g.16754
 ttga                                                               c.*304

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 31
©2004-2011 Leiden University Medical Center