tenascin XB (TNXB) - coding DNA reference sequence

(used for mutation description)

(last modified December 11, 2013)


This file was created to facilitate the description of sequence variants in the TNXB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008337.2, covering TNXB transcript NM_019105.6.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5022
                                       tcctccccttctcctcccctgc       c.-181

 .         .         .         .         .         .                g.5082
 tcgctgcagactccctcctcactgtcgctgccgagatccacagtcggttgtggctcagcc       c.-121

 .         .         .         .         .         .                g.5142
 cctgttgcaggggacaagtgagggagacttccctgtcctgccctgagacgccgccctccc       c.-61

 .         .         .         .         .         .  | 02          g.16176
 ggggttggggacagagcaggtgcagaggcactgcagctgctcggttgcccag | cctcctga    c.-1

          .         .         .         .         .         .       g.16236
 ATGATGCCAGCCCAGTATGCTCTAACCTCCAGCCTGGTTCTCCTGGTGCTGCTGAGCACA       c.60
 M  M  P  A  Q  Y  A  L  T  S  S  L  V  L  L  V  L  L  S  T         p.20

          .         .         .         .         .         .       g.16296
 GCCAGAGCAGGCCCCTTCTCTTCACGGTCCAATGTGACACTGCCAGCCCCCCGGCCCCCT       c.120
 A  R  A  G  P  F  S  S  R  S  N  V  T  L  P  A  P  R  P  P         p.40

          .         .         .         .         .         .       g.16356
 CCCCAGCCAGGGGGCCACACAGTGGGGGCTGGAGTGGGAAGCCCCTCTTCTCAGCTTTAC       c.180
 P  Q  P  G  G  H  T  V  G  A  G  V  G  S  P  S  S  Q  L  Y         p.60

          .         .         .         .         .         .       g.16416
 GAGCACACAGTGGAAGGAGGGGAGAAGCAGGTGGTATTCACCCACCGCATTAACCTGCCC       c.240
 E  H  T  V  E  G  G  E  K  Q  V  V  F  T  H  R  I  N  L  P         p.80

          .         .         .         .         .         .       g.16476
 CCTTCCACTGGCTGTGGCTGTCCCCCAGGCACCGAGCCCCCAGTCCTTGCTTCAGAGGTA       c.300
 P  S  T  G  C  G  C  P  P  G  T  E  P  P  V  L  A  S  E  V         p.100

          .         .         .         .         .         .       g.16536
 CAGGCCCTGAGGGTCCGTCTAGAGATCCTGGAGGAGTTGGTGAAGGGGCTCAAGGAACAG       c.360
 Q  A  L  R  V  R  L  E  I  L  E  E  L  V  K  G  L  K  E  Q         p.120

          .         .         .         .    | 03    .         .    g.16942
 TGCACTGGGGGATGTTGTCCTGCCTCTGCCCAAGCTGGCACAG | GTCAGACAGATGTGCGG    c.420
 C  T  G  G  C  C  P  A  S  A  Q  A  G  T  G |   Q  T  D  V  R      p.140

          .         .         .         .         .         .       g.17002
 ACCCTCTGCAGTCTCCATGGTGTGTTTGATCTGAGCCGCTGCACCTGTTCCTGTGAGCCA       c.480
 T  L  C  S  L  H  G  V  F  D  L  S  R  C  T  C  S  C  E  P         p.160

          .         .         .         .         .         .       g.17062
 GGCTGGGGTGGGCCCACCTGCTCAGACCCCACAGATGCTGAGATCCCTCCCTCTTCCCCA       c.540
 G  W  G  G  P  T  C  S  D  P  T  D  A  E  I  P  P  S  S  P         p.180

          .         .         .         .         .         .       g.17122
 CCCTCAGCCTCGGGGTCCTGCCCAGATGACTGCAATGATCAGGGTCGCTGTGTCCGTGGT       c.600
 P  S  A  S  G  S  C  P  D  D  C  N  D  Q  G  R  C  V  R  G         p.200

          .         .         .         .         .         .       g.17182
 CGTTGCGTGTGCTTTCCCGGCTACACTGGCCCCAGCTGTGGCTGGCCATCCTGTCCCGGG       c.660
 R  C  V  C  F  P  G  Y  T  G  P  S  C  G  W  P  S  C  P  G         p.220

          .         .         .         .         .         .       g.17242
 GACTGCCAAGGCCGTGGGCGCTGCGTGCAGGGCGTGTGTGTGTGCCGGGCAGGCTTCTCA       c.720
 D  C  Q  G  R  G  R  C  V  Q  G  V  C  V  C  R  A  G  F  S         p.240

          .         .         .         .         .         .       g.17302
 GGCCCCGACTGCAGCCAGCGCTCCTGCCCTCGAGGTTGCAGCCAGAGGGGACGCTGTGAG       c.780
 G  P  D  C  S  Q  R  S  C  P  R  G  C  S  Q  R  G  R  C  E         p.260

          .         .         .         .         .         .       g.17362
 GGTGGGCGCTGCGTGTGTGACCCAGGCTACACTGGTGACGACTGTGGCATGAGGAGCTGC       c.840
 G  G  R  C  V  C  D  P  G  Y  T  G  D  D  C  G  M  R  S  C         p.280

          .         .         .         .         .         .       g.17422
 CCTCGCGGTTGCAGTCAGAGGGGGCGCTGTGAGAATGGGCGCTGCGTGTGTAACCCCGGC       c.900
 P  R  G  C  S  Q  R  G  R  C  E  N  G  R  C  V  C  N  P  G         p.300

          .         .         .         .         .         .       g.17482
 TACACTGGCGAGGACTGTGGGGTGAGGAGCTGCCCTCGGGGCTGCAGCCAGCGGGGACGC       c.960
 Y  T  G  E  D  C  G  V  R  S  C  P  R  G  C  S  Q  R  G  R         p.320

          .         .         .         .         .         .       g.17542
 TGCAAGGACGGGCGCTGCGTGTGTGACCCCGGCTACACTGGCGAGGACTGTGGTACGCGG       c.1020
 C  K  D  G  R  C  V  C  D  P  G  Y  T  G  E  D  C  G  T  R         p.340

          .         .         .         .         .         .       g.17602
 AGCTGCCCCTGGGACTGTGGCGAGGGCGGGCGCTGCGTGGACGGCCGCTGCGTGTGCTGG       c.1080
 S  C  P  W  D  C  G  E  G  G  R  C  V  D  G  R  C  V  C  W         p.360

          .         .         .         .         .         .       g.17662
 CCCGGGTACACAGGCGAGGACTGCAGCACGCGGACATGTCCGAGGGACTGCCGGGGCCGC       c.1140
 P  G  Y  T  G  E  D  C  S  T  R  T  C  P  R  D  C  R  G  R         p.380

          .         .         .         .         .         .       g.17722
 GGGCGCTGCGAGGACGGCGAATGCATTTGCGACACGGGCTACAGCGGGGACGACTGCGGC       c.1200
 G  R  C  E  D  G  E  C  I  C  D  T  G  Y  S  G  D  D  C  G         p.400

          .         .         .         .         .         .       g.17782
 GTGCGCAGCTGCCCTGGCGACTGCAACCAAAGGGGCCGCTGCGAGGACGGCCGCTGCGTG       c.1260
 V  R  S  C  P  G  D  C  N  Q  R  G  R  C  E  D  G  R  C  V         p.420

          .         .         .         .         .         .       g.17842
 TGCTGGCCGGGGTACACTGGAACCGATTGCGGCTCGCGCGCCTGCCCACGCGACTGTAGA       c.1320
 C  W  P  G  Y  T  G  T  D  C  G  S  R  A  C  P  R  D  C  R         p.440

          .         .         .         .         .         .       g.17902
 GGTCGCGGGCGCTGCGAGAACGGCGTGTGTGTTTGCAATGCGGGCTACAGCGGCGAGGAC       c.1380
 G  R  G  R  C  E  N  G  V  C  V  C  N  A  G  Y  S  G  E  D         p.460

          .         .         .         .         .         .       g.17962
 TGCGGTGTGCGCAGCTGTCCTGGGGACTGTCGTGGCCGGGGCCGCTGTGAGAGTGGCCGC       c.1440
 C  G  V  R  S  C  P  G  D  C  R  G  R  G  R  C  E  S  G  R         p.480

          .         .         .         .         .         .       g.18022
 TGCATGTGTTGGCCGGGGTACACAGGCCGGGACTGCGGCACGCGCGCCTGTCCTGGCGAC       c.1500
 C  M  C  W  P  G  Y  T  G  R  D  C  G  T  R  A  C  P  G  D         p.500

          .         .         .         .         .         .       g.18082
 TGTCGCGGGCGCGGGCGCTGCGTGGATGGCCGCTGCGTGTGCAACCCGGGCTTCACCGGT       c.1560
 C  R  G  R  G  R  C  V  D  G  R  C  V  C  N  P  G  F  T  G         p.520

          .         .         .         .         .         .       g.18142
 GAGGACTGTGGGAGCCGTCGCTGTCCCGGGGACTGCCGTGGGCACGGCCTTTGCGAGGAT       c.1620
 E  D  C  G  S  R  R  C  P  G  D  C  R  G  H  G  L  C  E  D         p.540

          .         .         .         .         .         .       g.18202
 GGCGTGTGCGTGTGTGACGCAGGCTACTCAGGGGAAGACTGCAGCACGCGCAGCTGCCCC       c.1680
 G  V  C  V  C  D  A  G  Y  S  G  E  D  C  S  T  R  S  C  P         p.560

          .         .         .         .         .         .       g.18262
 GGGGGCTGCCGAGGCCGCGGCCAGTGCCTAGATGGGCGGTGTGTGTGCGAGGACGGCTAC       c.1740
 G  G  C  R  G  R  G  Q  C  L  D  G  R  C  V  C  E  D  G  Y         p.580

          .         .         .         .         .         .       g.18322
 TCTGGCGAGGATTGCGGTGTGAGGCAGTGCCCGAATGACTGCAGCCAGCACGGCGTGTGC       c.1800
 S  G  E  D  C  G  V  R  Q  C  P  N  D  C  S  Q  H  G  V  C         p.600

          .         .         .         .         .         .       g.18382
 CAGGACGGTGTGTGCATCTGTTGGGAAGGCTACGTGAGTGAGGACTGCAGCATCCGCACC       c.1860
 Q  D  G  V  C  I  C  W  E  G  Y  V  S  E  D  C  S  I  R  T         p.620

          .         .         .         .         .         .       g.18442
 TGCCCCTCCAACTGCCACGGGAGGGGCCGCTGTGAGGAAGGGCGCTGCCTGTGCGACCCA       c.1920
 C  P  S  N  C  H  G  R  G  R  C  E  E  G  R  C  L  C  D  P         p.640

          .         .         .         .         .         .       g.18502
 GGCTACACCGGCCCTACCTGTGCCACCCGCATGTGCCCGGCTGACTGCCGGGGACGTGGG       c.1980
 G  Y  T  G  P  T  C  A  T  R  M  C  P  A  D  C  R  G  R  G         p.660

          .         .         .         .         .         .       g.18562
 CGGTGTGTGCAAGGAGTGTGCCTGTGCCACGTGGGCTATGGCGGTGAGGACTGCGGGCAG       c.2040
 R  C  V  Q  G  V  C  L  C  H  V  G  Y  G  G  E  D  C  G  Q         p.680

          .         .         .         .         .         .       g.18622
 GAAGAGCCTCCAGCCAGCGCCTGCCCTGGAGGCTGCGGGCCCCGGGAACTGTGCCGGGCA       c.2100
 E  E  P  P  A  S  A  C  P  G  G  C  G  P  R  E  L  C  R  A         p.700

          .         .         .         .         .         .       g.18682
 GGCCAGTGTGTGTGTGTAGAGGGCTTCCGAGGCCCTGACTGTGCCATCCAGACATGCCCA       c.2160
 G  Q  C  V  C  V  E  G  F  R  G  P  D  C  A  I  Q  T  C  P         p.720

          .         .         .         .         .         .       g.18742
 GGGGACTGCCGTGGCCGAGGAGAGTGTCACGATGGCAGCTGTGTCTGCAAAGATGGGTAT       c.2220
 G  D  C  R  G  R  G  E  C  H  D  G  S  C  V  C  K  D  G  Y         p.740

          .         .   | 04     .         .         .         .    g.19221
 GCTGGCGAAGACTGCGGAGAAG | AGGTGCCAACCATTGAGGGCATGAGGATGCATCTCTTG    c.2280
 A  G  E  D  C  G  E  E |   V  P  T  I  E  G  M  R  M  H  L  L      p.760

          .         .         .         .         .         .       g.19281
 GAGGAGACAACAGTTCGGACAGAGTGGACCCCGGCTCCTGGCCCCGTGGATGCCTATGAA       c.2340
 E  E  T  T  V  R  T  E  W  T  P  A  P  G  P  V  D  A  Y  E         p.780

          .         | 05         .         .         .         .    g.25037
 ATTCAGTTCATCCCCACG | ACAGAGGGGGCGAGCCCCCCATTCACAGCACGGGTTCCAAGC    c.2400
 I  Q  F  I  P  T   | T  E  G  A  S  P  P  F  T  A  R  V  P  S      p.800

          .         .         .         .         .         .       g.25097
 TCTGCCTCAGCCTATGACCAGAGAGGACTGGCCCCTGGACAGGAGTACCAGGTCACTGTC       c.2460
 S  A  S  A  Y  D  Q  R  G  L  A  P  G  Q  E  Y  Q  V  T  V         p.820

          .         .         .         .         .      | 06  .    g.25331
 CGAGCCCTTCGAGGGACCAGCTGGGGCCTTCCTGCCTCCAAGACCATCACCACCA | TGATC    c.2520
 R  A  L  R  G  T  S  W  G  L  P  A  S  K  T  I  T  T  M |   I      p.840

          .         .         .         .         .         .       g.25391
 GATGGGCCCCAGGACCTCCGAGTGGTGGCTGTGACACCGACAACACTGGAGCTTGGCTGG       c.2580
 D  G  P  Q  D  L  R  V  V  A  V  T  P  T  T  L  E  L  G  W         p.860

          .         .         .         .         .         .       g.25451
 CTGCGTCCCCAGGCTGAGGTGGACCGATTTGTGGTGTCCTACGTCAGTGCCGGCAACCAG       c.2640
 L  R  P  Q  A  E  V  D  R  F  V  V  S  Y  V  S  A  G  N  Q         p.880

          .         .         .         .         .         .       g.25511
 AGGGTGAGGCTGGAAGTGCCCCCTGAAGCAGACGGGACGCTGCTGACTGACCTGATGCCA       c.2700
 R  V  R  L  E  V  P  P  E  A  D  G  T  L  L  T  D  L  M  P         p.900

          .         .         .         .         .         .       g.25571
 GGCGTAGAATATGTGGTGACTGTCACAGCGGAGCGGGGCCGGGCAGTCAGCTACCCAGCT       c.2760
 G  V  E  Y  V  V  T  V  T  A  E  R  G  R  A  V  S  Y  P  A         p.920

          .          | 07        .         .         .         .    g.28297
 TCTGTCAGGGCCAACACAG | GGTCCTCACCCTTGGGCCTCTTGGGGACTACCGATGAGCCT    c.2820
 S  V  R  A  N  T  G |   S  S  P  L  G  L  L  G  T  T  D  E  P      p.940

          .         .         .         .         .         .       g.28357
 CCTCCCTCAGGCCCCTCGACGACGCAAGGGGCCCAGGCTCCTCTCCTGCAGCAGCGCCCC       c.2880
 P  P  S  G  P  S  T  T  Q  G  A  Q  A  P  L  L  Q  Q  R  P         p.960

          .         .         .         .         .         .       g.28417
 CAGGAGCTGGGAGAGTTGAGGGTGCTGGGCAGAGATGAGACAGGGCGCCTCCGTGTGGTC       c.2940
 Q  E  L  G  E  L  R  V  L  G  R  D  E  T  G  R  L  R  V  V         p.980

          .         .         .         .         .         .       g.28477
 TGGACCGCCCAGCCTGACACCTTTGCCTACTTCCAACTGCGCATGCGGGTGCCCGAGGGG       c.3000
 W  T  A  Q  P  D  T  F  A  Y  F  Q  L  R  M  R  V  P  E  G         p.1000

          .         .         .         .         .         .       g.28537
 CCGGGGGCACATGAGGAAGTGCTGCCAGGGGACGTCCGCCAGGCTCTGGTGCCTCCACCC       c.3060
 P  G  A  H  E  E  V  L  P  G  D  V  R  Q  A  L  V  P  P  P         p.1020

          .         .         .         .         .         .       g.28597
 CCTCCTGGAACCCCGTATGAGCTGTCACTTCATGGGGTCCCTCCTGGGGGCAAGCCCTCT       c.3120
 P  P  G  T  P  Y  E  L  S  L  H  G  V  P  P  G  G  K  P  S         p.1040

          .         .         | 08         .         .         .    g.29697
 GACCCCATCATCTACCAAGGCATTATGG | ACAAGGATGAGGAGAAGCCTGGGAAGTCCTCA    c.3180
 D  P  I  I  Y  Q  G  I  M  D |   K  D  E  E  K  P  G  K  S  S      p.1060

          .         .         .         .         .         .       g.29757
 GGCCCACCACGCCTGGGTGAGCTGACGGTGACAGACAGGACCTCCGACTCCTTGCTCCTG       c.3240
 G  P  P  R  L  G  E  L  T  V  T  D  R  T  S  D  S  L  L  L         p.1080

          .         .         .         .         .         .       g.29817
 CGCTGGACGGTCCCCGAGGGCGAGTTTGACTCCTTCGTGATCCAGTACAAAGACAGGGAC       c.3300
 R  W  T  V  P  E  G  E  F  D  S  F  V  I  Q  Y  K  D  R  D         p.1100

          .         .         .         .         .         .       g.29877
 GGGCAGCCCCAGGTGGTGCCCGTGGAAGGACCCCAGCGCTCGGCCGTCATCACCTCCCTG       c.3360
 G  Q  P  Q  V  V  P  V  E  G  P  Q  R  S  A  V  I  T  S  L         p.1120

          .         .         .         .         .         .       g.29937
 GATCCTGGCCGCAAGTACAAATTTGTCCTGTATGGGTTTGTTGGCAAGAAGAGGCATGGT       c.3420
 D  P  G  R  K  Y  K  F  V  L  Y  G  F  V  G  K  K  R  H  G         p.1140

          .         .      | 09  .         .         .         .    g.32083
 CCGCTGGTGGCTGAAGCCAAGATCT | TGCCTCAGAGTGACCCAAGTCCAGGGACTCCACCC    c.3480
 P  L  V  A  E  A  K  I  L |   P  Q  S  D  P  S  P  G  T  P  P      p.1160

          .         .         .         .         .         .       g.32143
 CACCTGGGAAACCTGTGGGTGACAGACCCTACCCCAGATTCACTGCACCTCTCCTGGACT       c.3540
 H  L  G  N  L  W  V  T  D  P  T  P  D  S  L  H  L  S  W  T         p.1180

          .         .         .         .         .         .       g.32203
 GTCCCTGAGGGCCAGTTTGACACCTTCATGGTCCAGTACAGGGACAGGGATGGACGGCCC       c.3600
 V  P  E  G  Q  F  D  T  F  M  V  Q  Y  R  D  R  D  G  R  P         p.1200

          .         .         .         .         .         .       g.32263
 CAGGTGGTACCTGTGGAAGGGCCCGAGCGTTCATTTGTTGTCTCCTCACTGGACCCTGAC       c.3660
 Q  V  V  P  V  E  G  P  E  R  S  F  V  V  S  S  L  D  P  D         p.1220

          .         .         .         .         .         .       g.32323
 CACAAGTACAGATTCACTCTGTTTGGAATTGCGAACAAGAAGCGGTATGGCCCCCTCACG       c.3720
 H  K  Y  R  F  T  L  F  G  I  A  N  K  K  R  Y  G  P  L  T         p.1240

          .       | 10 .         .         .         .         .    g.32745
 GCCGATGGCACCACTG | CTCCAGAGAGGAAAGAGGAGCCCCCCCGCCCTGAGTTCCTGGAG    c.3780
 A  D  G  T  T  A |   P  E  R  K  E  E  P  P  R  P  E  F  L  E      p.1260

          .         .         .         .         .         .       g.32805
 CAGCCCCTCCTGGGGGAACTGACAGTGACCGGCGTGACCCCAGACTCCTTGCGTCTCTCA       c.3840
 Q  P  L  L  G  E  L  T  V  T  G  V  T  P  D  S  L  R  L  S         p.1280

          .         .         .         .         .         .       g.32865
 TGGACAGTGGCCCAGGGCCCCTTCGACTCATTCATGGTCCAGTACAAGGATGCACAGGGG       c.3900
 W  T  V  A  Q  G  P  F  D  S  F  M  V  Q  Y  K  D  A  Q  G         p.1300

          .         .         .         .         .         .       g.32925
 CAGCCCCAGGCAGTGCCTGTTGCGGGGGATGAGAATGAGGTTACTGTCCCCGGCCTGGAT       c.3960
 Q  P  Q  A  V  P  V  A  G  D  E  N  E  V  T  V  P  G  L  D         p.1320

          .         .         .         .         .         .       g.32985
 CCCGACCGGAAGTATAAGATGAACCTCTACGGGCTTCGTGGCAGGCAGCGTGTGGGGCCC       c.4020
 P  D  R  K  Y  K  M  N  L  Y  G  L  R  G  R  Q  R  V  G  P         p.1340

          .         .   | 11     .         .         .         .    g.35047
 GAGTCTGTGGTGGCCAAGACTG | CTCCTCAGGAGGATGTGGACGAGACCCCCAGCCCCACA    c.4080
 E  S  V  V  A  K  T  A |   P  Q  E  D  V  D  E  T  P  S  P  T      p.1360

          .         .         .         .         .         .       g.35107
 GAACTGGGCACGGAGGCCCCGGAGTCCCCCGAGGAGCCGCTCCTGGGGGAGCTGACAGTG       c.4140
 E  L  G  T  E  A  P  E  S  P  E  E  P  L  L  G  E  L  T  V         p.1380

          .         .         .         .         .         .       g.35167
 ACAGGATCCTCCCCTGATTCGCTGAGCCTCTTCTGGACCGTCCCCCAGGGCAGCTTCGAC       c.4200
 T  G  S  S  P  D  S  L  S  L  F  W  T  V  P  Q  G  S  F  D         p.1400

          .         .         .         .         .         .       g.35227
 TCTTTCACCGTGCAGTACAAGGACAGGGATGGGCGGCCCCGGGCGGTGCGTGTTGGGGGC       c.4260
 S  F  T  V  Q  Y  K  D  R  D  G  R  P  R  A  V  R  V  G  G         p.1420

          .         .         .         .         .         .       g.35287
 AAGGAGAGTGAGGTCACCGTGGGAGGCCTAGAGCCCGGGCACAAGTACAAGATGCACCTG       c.4320
 K  E  S  E  V  T  V  G  G  L  E  P  G  H  K  Y  K  M  H  L         p.1440

          .         .         .         .         .      | 12  .    g.40427
 TACGGCCTCCACGAGGGGCAGCGCGTGGGCCCGGTGTCCGCCGTGGGCGTGACAG | CCCCA    c.4380
 Y  G  L  H  E  G  Q  R  V  G  P  V  S  A  V  G  V  T  A |   P      p.1460

          .         .         .         .         .         .       g.40487
 CAACAAGAAGAGACCCCTCCAGCCACTGAGTCCCCGCTGGAGCCACGCCTAGGAGAGCTG       c.4440
 Q  Q  E  E  T  P  P  A  T  E  S  P  L  E  P  R  L  G  E  L         p.1480

          .         .         .         .         .         .       g.40547
 ACAGTGACAGATGTGACCCCCAACTCTGTGGGCCTCTCCTGGACAGTCCCCGAGGGCCAG       c.4500
 T  V  T  D  V  T  P  N  S  V  G  L  S  W  T  V  P  E  G  Q         p.1500

          .         .         .         .         .         .       g.40607
 TTTGACTCCTTCATAGTCCAGTACAAGGACAAGGACGGGCAGCCCCAGGTGGTGCCGGTG       c.4560
 F  D  S  F  I  V  Q  Y  K  D  K  D  G  Q  P  Q  V  V  P  V         p.1520

          .         .         .         .         .         .       g.40667
 GCGGCAGACCAGCGAGAGGTCACAGTCTACAACCTGGAGCCTGAGAGAAAATATAAGATG       c.4620
 A  A  D  Q  R  E  V  T  V  Y  N  L  E  P  E  R  K  Y  K  M         p.1540

          .         .         .         .         .         .       g.40727
 AACATGTATGGACTACATGATGGGCAACGCATGGGCCCCCTGTCTGTGGTCATCGTGACG       c.4680
 N  M  Y  G  L  H  D  G  Q  R  M  G  P  L  S  V  V  I  V  T         p.1560

   | 13      .         .         .         .         .         .    g.42135
 G | CTCCCCTCCCACCAGCCCCAGCCACAGAGGCCTCCAAGCCTCCCCTGGAGCCACGCCTA    c.4740
 A |   P  L  P  P  A  P  A  T  E  A  S  K  P  P  L  E  P  R  L      p.1580

          .         .         .         .         .         .       g.42195
 GGGGAGCTGACAGTGACGGATATAACCCCTGACTCTGTGGGCCTCTCATGGACAGTCCCT       c.4800
 G  E  L  T  V  T  D  I  T  P  D  S  V  G  L  S  W  T  V  P         p.1600

          .         .         .         .         .         .       g.42255
 GAGGGTGAATTCGACTCCTTTGTGGTTCAGTACAAGGACAGGGACGGGCAGCCCCAGGTG       c.4860
 E  G  E  F  D  S  F  V  V  Q  Y  K  D  R  D  G  Q  P  Q  V         p.1620

          .         .         .         .         .         .       g.42315
 GTGCCCGTGGCTGCAGATCAGCGGGAGGTCACTATCCCTGACCTGGAACCCTCCCGCAAG       c.4920
 V  P  V  A  A  D  Q  R  E  V  T  I  P  D  L  E  P  S  R  K         p.1640

          .         .         .         .         .         .       g.42375
 TACAAGTTCCTGCTCTTTGGGATCCAGGATGGGAAACGACGCAGCCCAGTCTCTGTGGAG       c.4980
 Y  K  F  L  L  F  G  I  Q  D  G  K  R  R  S  P  V  S  V  E         p.1660

          . | 14       .         .         .         .         .    g.44010
 GCAAAGACGG | TTGCCCGAGGTGACGCCAGCCCAGGGGCCCCACCCCGCCTTGGGGAGCTG    c.5040
 A  K  T  V |   A  R  G  D  A  S  P  G  A  P  P  R  L  G  E  L      p.1680

          .         .         .         .         .         .       g.44070
 TGGGTGACAGACCCCACCCCAGACTCACTGCGCCTCTCCTGGACGGTTCCTGAGGGCCAG       c.5100
 W  V  T  D  P  T  P  D  S  L  R  L  S  W  T  V  P  E  G  Q         p.1700

          .         .         .         .         .         .       g.44130
 TTCGACTCTTTTGTGGTCCAGTTCAAGGACAAAGACGGGCCCCAGGTGGTGCCCGTGGAG       c.5160
 F  D  S  F  V  V  Q  F  K  D  K  D  G  P  Q  V  V  P  V  E         p.1720

          .         .         .         .         .         .       g.44190
 GGCCATGAGCGCTCTGTCACTGTCACCCCTCTGGATGCCGGCCGCAAGTACAGATTCCTC       c.5220
 G  H  E  R  S  V  T  V  T  P  L  D  A  G  R  K  Y  R  F  L         p.1740

          .         .         .         .         .         | 15    g.44515
 CTCTATGGCCTCCTGGGCAAGAAGCGCCATGGCCCTCTCACTGCCGACGGCACCACGG | AA    c.5280
 L  Y  G  L  L  G  K  K  R  H  G  P  L  T  A  D  G  T  T  E |       p.1760

          .         .         .         .         .         .       g.44575
 GCCCGGAGTGCTATGGATGATACTGGAACAAAGCGTCCCCCAAAACCCCGTCTGGGGGAG       c.5340
 A  R  S  A  M  D  D  T  G  T  K  R  P  P  K  P  R  L  G  E         p.1780

          .         .         .         .         .         .       g.44635
 GAGCTGCAGGTGACCACCGTGACCCAGAACTCCGTGGGCCTCTCCTGGACAGTCCCTGAG       c.5400
 E  L  Q  V  T  T  V  T  Q  N  S  V  G  L  S  W  T  V  P  E         p.1800

          .         .         .         .         .         .       g.44695
 GGCCAGTTTGACTCCTTTGTGGTCCAGTACAAAGACAGGGACGGGCAGCCCCAGGTGGTG       c.5460
 G  Q  F  D  S  F  V  V  Q  Y  K  D  R  D  G  Q  P  Q  V  V         p.1820

          .         .         .         .         .         .       g.44755
 CCCGTGGAGGGCAGCCTCAGGGAGGTCAGCGTGCCGGGCCTGGACCCTGCCCACAGGTAC       c.5520
 P  V  E  G  S  L  R  E  V  S  V  P  G  L  D  P  A  H  R  Y         p.1840

          .         .         .         .         .         .       g.44815
 AAGCTGCTGCTCTACGGGCTGCACCACGGCAAGCGTGTGGGCCCCATCTCGGCCGTCGCC       c.5580
 K  L  L  L  Y  G  L  H  H  G  K  R  V  G  P  I  S  A  V  A         p.1860

         | 16.         .         .         .         .         .    g.45291
 ATTACTG | CCGGCAGGGAAGAAACGGAAACTGAGACCACGGCCCCGACCCCTCCAGCGCCT    c.5640
 I  T  A |   G  R  E  E  T  E  T  E  T  T  A  P  T  P  P  A  P      p.1880

          .         .         .         .         .         .       g.45351
 GAGCCCCACCTCGGGGAGTTGACAGTGGAGGAGGCCACGTCACACACCCTGCATCTCTCC       c.5700
 E  P  H  L  G  E  L  T  V  E  E  A  T  S  H  T  L  H  L  S         p.1900

          .         .         .         .         .         .       g.45411
 TGGATGGTGACTGAGGGAGAATTTGACTCCTTCGAAATCCAGTACACAGATAGAGACGGG       c.5760
 W  M  V  T  E  G  E  F  D  S  F  E  I  Q  Y  T  D  R  D  G         p.1920

          .         .         .         .         .         .       g.45471
 CAACTCCAAATGGTCCGCATAGGAGGTGACCGGAATGACATCACCCTCTCTGGCCTGGAA       c.5820
 Q  L  Q  M  V  R  I  G  G  D  R  N  D  I  T  L  S  G  L  E         p.1940

          .         .         .         .         .         .       g.45531
 TCCGACCACAGATACCTGGTGACCCTGTATGGTTTCAGTGATGGGAAGCATGTAGGTCCT       c.5880
 S  D  H  R  Y  L  V  T  L  Y  G  F  S  D  G  K  H  V  G  P         p.1960

          .         .   | 17     .         .         .         .    g.45705
 GTCCATGTCGAGGCCCTGACAG | TCCCGGAGGAGGAGAAGCCTTCAGAACCTCCCACCGCA    c.5940
 V  H  V  E  A  L  T  V |   P  E  E  E  K  P  S  E  P  P  T  A      p.1980

          .         .         .         .         .         .       g.45765
 ACCCCCGAGCCCCCCATCAAGCCTCGCCTGGGGGAGCTGACCGTGACAGATGCCACCCCT       c.6000
 T  P  E  P  P  I  K  P  R  L  G  E  L  T  V  T  D  A  T  P         p.2000

          .         .         .         .         .         .       g.45825
 GACTCCCTCAGCCTGTCCTGGACAGTTCCCGAGGGACAGTTTGACCACTTCCTGGTCCAG       c.6060
 D  S  L  S  L  S  W  T  V  P  E  G  Q  F  D  H  F  L  V  Q         p.2020

          .         .         .         .         .         .       g.45885
 TACAGGAATGGAGATGGGCAGCCCAAGGCAGTGAGGGTGCCAGGGCACGAGGAAGGGGTC       c.6120
 Y  R  N  G  D  G  Q  P  K  A  V  R  V  P  G  H  E  E  G  V         p.2040

          .         .         .         .         .         .       g.45945
 ACCATCTCGGGCCTGGAGCCAGACCATAAATACAAGATGAACCTGTACGGCTTCCACGGT       c.6180
 T  I  S  G  L  E  P  D  H  K  Y  K  M  N  L  Y  G  F  H  G         p.2060

          .         .         .         . | 18       .         .    g.46410
 GGCCAGCGCATGGGCCCTGTGTCTGTCGTCGGGGTGACAG | CTGCAGAGGAAGAGACCCCC    c.6240
 G  Q  R  M  G  P  V  S  V  V  G  V  T  A |   A  E  E  E  T  P      p.2080

          .         .         .         .         .         .       g.46470
 AGCCCCACAGAACCCAGCATGGAGGCCCCGGAGCCCGCTGAGGAGCCGCTCCTGGGGGAG       c.6300
 S  P  T  E  P  S  M  E  A  P  E  P  A  E  E  P  L  L  G  E         p.2100

          .         .         .         .         .         .       g.46530
 CTAACAGTGACAGGATCCTCCCCTGACTCGCTGAGCCTCTCCTGGACCGTCCCCCAGGGC       c.6360
 L  T  V  T  G  S  S  P  D  S  L  S  L  S  W  T  V  P  Q  G         p.2120

          .         .         .         .         .         .       g.46590
 CGCTTCGACTCCTTCACCGTGCAGTACAAGGACAGGGACGGGCGGCCCCAGGTGGTGCGT       c.6420
 R  F  D  S  F  T  V  Q  Y  K  D  R  D  G  R  P  Q  V  V  R         p.2140

          .         .         .         .         .         .       g.46650
 GTTGGGGGCGAGGAGAGTGAAGTCACCGTGGGGGGCCTGGAGCCTGGGCGCAAGTACAAG       c.6480
 V  G  G  E  E  S  E  V  T  V  G  G  L  E  P  G  R  K  Y  K         p.2160

          .         .         .         .         .         .       g.46710
 ATGCACCTGTACGGCCTCCACGAGGGGCGGCGCGTGGGCCCAGTGTCTGCTGTGGGCGTC       c.6540
 M  H  L  Y  G  L  H  E  G  R  R  V  G  P  V  S  A  V  G  V         p.2180

      | 19   .         .         .         .         .         .    g.49313
 ACGG | CCCCCGAAGAGGAGTCCCCTGATGCTCCTCTTGCAAAGCTGCGCCTAGGGCAGATG    c.6600
 T  A |   P  E  E  E  S  P  D  A  P  L  A  K  L  R  L  G  Q  M      p.2200

          .         .         .         .         .         .       g.49373
 ACAGTGAGAGACATCACCTCCGACTCCCTCAGCCTCTCCTGGACAGTCCCCGAGGGCCAG       c.6660
 T  V  R  D  I  T  S  D  S  L  S  L  S  W  T  V  P  E  G  Q         p.2220

          .         .         .         .         .         .       g.49433
 TTTGACCATTTCTTGGTCCAGTTTAAGAATGGGGACGGGCAGCCCAAGGCGGTGCGGGTG       c.6720
 F  D  H  F  L  V  Q  F  K  N  G  D  G  Q  P  K  A  V  R  V         p.2240

          .         .         .         .         .         .       g.49493
 CCGGGACACGAGGATGGGGTCACCATCTCGGGCCTGGAGCCAGACCACAAGTACAAGATG       c.6780
 P  G  H  E  D  G  V  T  I  S  G  L  E  P  D  H  K  Y  K  M         p.2260

          .         .         .         .         .         .       g.49553
 AACCTGTACGGCTTCCACGGTGGCCAGCGCGTGGGCCCCGTGTCTGCTGTTGGTTTAACT       c.6840
 N  L  Y  G  F  H  G  G  Q  R  V  G  P  V  S  A  V  G  L  T         p.2280

   | 20      .         .         .         .         .         .    g.51950
 G | CCCCAGGAAAGGATGAAGAAATGGCCCCAGCCTCGACAGAACCTCCCACCCCTGAACCC    c.6900
 A |   P  G  K  D  E  E  M  A  P  A  S  T  E  P  P  T  P  E  P      p.2300

          .         .         .         .         .         .       g.52010
 CCCATCAAGCCTCGCCTGGAGGAGCTGACCGTGACAGATGCGACCCCTGACTCCCTCAGC       c.6960
 P  I  K  P  R  L  E  E  L  T  V  T  D  A  T  P  D  S  L  S         p.2320

          .         .         .         .         .         .       g.52070
 CTGTCCTGGACGGTTCCCGAGGGACAGTTTGACCACTTCCTGGTCCAGTACAAGAATGGG       c.7020
 L  S  W  T  V  P  E  G  Q  F  D  H  F  L  V  Q  Y  K  N  G         p.2340

          .         .         .         .         .         .       g.52130
 GATGGGCAGCCCAAGGCAACACGGGTGCCAGGACATGAGGACAGGGTCACCATCTCCGGC       c.7080
 D  G  Q  P  K  A  T  R  V  P  G  H  E  D  R  V  T  I  S  G         p.2360

          .         .         .         .         .         .       g.52190
 CTGGAGCCAGACAACAAGTACAAGATGAACCTGTACGGCTTCCACGGTGGCCAGCGTGTG       c.7140
 L  E  P  D  N  K  Y  K  M  N  L  Y  G  F  H  G  G  Q  R  V         p.2380

          .         .         | 21         .         .         .    g.52686
 GGCCCCGTGTCTGCCATCGGGGTGACAG | CTGCAGAGGAAGAGACCCCCAGCCCCACAGAA    c.7200
 G  P  V  S  A  I  G  V  T  A |   A  E  E  E  T  P  S  P  T  E      p.2400

          .         .         .         .         .         .       g.52746
 CCCAGCATGGAGGCCCCGGAGCCCCCTGAGGAGCCGCTCCTGGGGGAGCTAACAGTGACA       c.7260
 P  S  M  E  A  P  E  P  P  E  E  P  L  L  G  E  L  T  V  T         p.2420

          .         .         .         .         .         .       g.52806
 GGATCCTCCCCTGACTCGCTGAGCCTCTCCTGGACCGTCCCCCAGGGCCGCTTCGACTCC       c.7320
 G  S  S  P  D  S  L  S  L  S  W  T  V  P  Q  G  R  F  D  S         p.2440

          .         .         .         .         .         .       g.52866
 TTCACCGTGCAGTACAAGGACAGGGACGGGCGGCCCCAGGTGGTGCGTGTTGGGGGCGAG       c.7380
 F  T  V  Q  Y  K  D  R  D  G  R  P  Q  V  V  R  V  G  G  E         p.2460

          .         .         .         .         .         .       g.52926
 GAGAGCGAGGTCACCGTGGGGGGCCTGGAGCCTGGGCGCAAATACAAGATGCACCTGTAT       c.7440
 E  S  E  V  T  V  G  G  L  E  P  G  R  K  Y  K  M  H  L  Y         p.2480

          .         .         .         .         .   | 22     .    g.55992
 GGCCTCCACGAGGGGCGGCGCGTGGGCCCGGTGTCCACCGTGGGCGTGACTG | CCCCACAA    c.7500
 G  L  H  E  G  R  R  V  G  P  V  S  T  V  G  V  T  A |   P  Q      p.2500

          .         .         .         .         .         .       g.56052
 GAGGATGTGGACGAGACCCCCAGCCCTACAGAACCAGGCACAGAGGCCCCAGGGCCCCCC       c.7560
 E  D  V  D  E  T  P  S  P  T  E  P  G  T  E  A  P  G  P  P         p.2520

          .         .         .         .         .         .       g.56112
 GAGGAGCCTCTCCTGGGGGAGCTGACAGTGACAGGATCCTCCCCTGACTCGCTGAGCCTT       c.7620
 E  E  P  L  L  G  E  L  T  V  T  G  S  S  P  D  S  L  S  L         p.2540

          .         .         .         .         .         .       g.56172
 TCCTGGACCGTCCCCCAGGGCCGCTTTGACTCCTTCACCGTGCAGTACAAGGACAGGGAC       c.7680
 S  W  T  V  P  Q  G  R  F  D  S  F  T  V  Q  Y  K  D  R  D         p.2560

          .         .         .         .         .         .       g.56232
 GGGCGGCCCCAGGCGGTGCGTGTTGGGGGCCAGGAGAGCAAGGTCACTGTGAGGGGCCTG       c.7740
 G  R  P  Q  A  V  R  V  G  G  Q  E  S  K  V  T  V  R  G  L         p.2580

          .         .         .         .         .         .       g.56292
 GAGCCTGGGCGCAAGTACAAGATGCACCTGTACGGCCTCCACGAGGGGCGGCGCCTGGGC       c.7800
 E  P  G  R  K  Y  K  M  H  L  Y  G  L  H  E  G  R  R  L  G         p.2600

          .         .      | 23  .         .         .         .    g.57506
 CCGGTGTCTGCCGTGGGCGTCACAG | AGGATGAAGCCGAGACCACCCAAGCAGTGCCTACC    c.7860
 P  V  S  A  V  G  V  T  E |   D  E  A  E  T  T  Q  A  V  P  T      p.2620

          .         .         .         .         .         .       g.57566
 ATGACCCCTGAGCCCCCCATCAAGCCTCGCCTGGGGGAGCTGACCATGACAGATGCCACC       c.7920
 M  T  P  E  P  P  I  K  P  R  L  G  E  L  T  M  T  D  A  T         p.2640

          .         .         .         .         .         .       g.57626
 CCTGACTCCCTCAGCCTGTCCTGGACGGTTCCCGAGGGCCAGTTTGACCACTTCCTGGTC       c.7980
 P  D  S  L  S  L  S  W  T  V  P  E  G  Q  F  D  H  F  L  V         p.2660

          .         .         .         .         .         .       g.57686
 CAGTACAGGAATGGGGATGGGCAGCCCAAGGCGGTGCGGGTGCCGGGGCACGAGGACGGG       c.8040
 Q  Y  R  N  G  D  G  Q  P  K  A  V  R  V  P  G  H  E  D  G         p.2680

          .         .         .         .         .         .       g.57746
 GTCACCATCTCAGGCCTGGAGCCAGACCATAAATACAAGATGAACCTGTACGGCTTCCAC       c.8100
 V  T  I  S  G  L  E  P  D  H  K  Y  K  M  N  L  Y  G  F  H         p.2700

          .         .         .         .    | 24    .         .    g.58217
 GGTGGCCAGCGCGTGGGCCCCATCTCTGTCATTGGGGTGACGG | CTGCAGAGGAAGAGACC    c.8160
 G  G  Q  R  V  G  P  I  S  V  I  G  V  T  A |   A  E  E  E  T      p.2720

          .         .         .         .         .         .       g.58277
 CCCAGCCCCACGGAACTCAGCACTGAGGCCCCGGAGCCCCCTGAGGAGCCGCTCCTGGGG       c.8220
 P  S  P  T  E  L  S  T  E  A  P  E  P  P  E  E  P  L  L  G         p.2740

          .         .         .         .         .         .       g.58337
 GAGCTGACAGTGACAGGATCCTCCCCTGACTCGCTGAGCCTCTCCTGGACCATCCCCCAG       c.8280
 E  L  T  V  T  G  S  S  P  D  S  L  S  L  S  W  T  I  P  Q         p.2760

          .         .         .         .         .         .       g.58397
 GGCCACTTCGACTCCTTCACCGTGCAGTACAAGGACAGGGACGGGCGGCCCCAGGTGATG       c.8340
 G  H  F  D  S  F  T  V  Q  Y  K  D  R  D  G  R  P  Q  V  M         p.2780

          .         .         .         .         .         .       g.58457
 CGTGTCAGGGGCGAGGAGAGCGAGGTCACCGTGGGGGGCCTGGAGCCCGGGCGCAAATAC       c.8400
 R  V  R  G  E  E  S  E  V  T  V  G  G  L  E  P  G  R  K  Y         p.2800

          .         .         .         .         .         .       g.58517
 AAGATGCACCTGTACGGCCTCCACGAGGGGCGGCGTGTGGGCCCGGTGTCCACCGTGGGT       c.8460
 K  M  H  L  Y  G  L  H  E  G  R  R  V  G  P  V  S  T  V  G         p.2820

         | 25.         .         .         .         .         .    g.60722
 GTGACAG | AGGATGAAGCAGAGACCACCCAAGCAGTGCCCACCACAACCCCTGAGCCCCCC    c.8520
 V  T  E |   D  E  A  E  T  T  Q  A  V  P  T  T  T  P  E  P  P      p.2840

          .         .         .         .         .         .       g.60782
 AACAAGCCTCGCCTCGGGGAGCTGACCGTGACAGATGCCACCCCTGACTCCCTCAGCCTG       c.8580
 N  K  P  R  L  G  E  L  T  V  T  D  A  T  P  D  S  L  S  L         p.2860

          .         .         .         .         .         .       g.60842
 TCCTGGATGGTCCCCGAGGGCCAGTTTGACCACTTCCTGGTCCAGTACAGGAATGGGGAT       c.8640
 S  W  M  V  P  E  G  Q  F  D  H  F  L  V  Q  Y  R  N  G  D         p.2880

          .         .         .         .         .         .       g.60902
 GGGCAGCCCAAGGTGGTGCGGGTGCCGGGGCACGAGGACGGGGTCACCATCTCAGGCCTG       c.8700
 G  Q  P  K  V  V  R  V  P  G  H  E  D  G  V  T  I  S  G  L         p.2900

          .         .         .         .         .         .       g.60962
 GAGCCAGACCACAAGTACAAGATGAACCTGTACGGCTTCCACGGTGGCCAGCGCGTGGGC       c.8760
 E  P  D  H  K  Y  K  M  N  L  Y  G  F  H  G  G  Q  R  V  G         p.2920

          .         .      | 26  .         .         .         .    g.61416
 CCCATCTCTGTCATTGGGGTGACAG | CTGCAGAGGAAGAAACTCCCGCCCCCACAGAACCC    c.8820
 P  I  S  V  I  G  V  T  A |   A  E  E  E  T  P  A  P  T  E  P      p.2940

          .         .         .         .         .         .       g.61476
 AGCACGGAGGCCCCGGAGCCCCCTGAGGAGCCGCTCCTGGGGGAGCTGACAGTGACAGGA       c.8880
 S  T  E  A  P  E  P  P  E  E  P  L  L  G  E  L  T  V  T  G         p.2960

          .         .         .         .         .         .       g.61536
 TCCTCCCCTGACTCGCTGAGCCTCTCCTGGACCATCCCCCAGGGCCGCTTCGACTCCTTC       c.8940
 S  S  P  D  S  L  S  L  S  W  T  I  P  Q  G  R  F  D  S  F         p.2980

          .         .         .         .         .         .       g.61596
 ACTGTGCAGTACAAGGACAGGGACGGGCGGCCCCAGGTGGTGCGTGTCAGGGGCGAGGAG       c.9000
 T  V  Q  Y  K  D  R  D  G  R  P  Q  V  V  R  V  R  G  E  E         p.3000

          .         .         .         .         .         .       g.61656
 AGCGAGGTCACCGTGGGGGGCCTGGAGCCCGGGTGCAAATACAAGATGCACCTGTACGGC       c.9060
 S  E  V  T  V  G  G  L  E  P  G  C  K  Y  K  M  H  L  Y  G         p.3020

          .         .         .         .          | 27        .    g.64064
 CTCCACGAGGGGCAGCGCGTGGGCCCAGTGTCCGCTGTGGGTGTGACAG | CTCCAAAGGAT    c.9120
 L  H  E  G  Q  R  V  G  P  V  S  A  V  G  V  T  A |   P  K  D      p.3040

          .         .         .         .         .         .       g.64124
 GAAGCCGAGACCACCCAAGCAGTGCCTACCATGACCCCTGAGCCCCCCATCAAGCCTCGC       c.9180
 E  A  E  T  T  Q  A  V  P  T  M  T  P  E  P  P  I  K  P  R         p.3060

          .         .         .         .         .         .       g.64184
 CTGGGGGAGCTGACCGTGACAGATGCCACCCCCGACTCCCTCAGCCTGTCCTGGATGGTT       c.9240
 L  G  E  L  T  V  T  D  A  T  P  D  S  L  S  L  S  W  M  V         p.3080

          .         .         .         .         .         .       g.64244
 CCCGAGGGCCAGTTTGACCACTTCCTGGTCCAGTACAGGAATGGGGATGGGCAGCCCAAG       c.9300
 P  E  G  Q  F  D  H  F  L  V  Q  Y  R  N  G  D  G  Q  P  K         p.3100

          .         .         .         .         .         .       g.64304
 GCGGTGCGGGTGCCGGGGCACGAGGACGGGGTCACCATCTCAGGCCTGGAGCCAGACCAT       c.9360
 A  V  R  V  P  G  H  E  D  G  V  T  I  S  G  L  E  P  D  H         p.3120

          .         .         .         .         .         .       g.64364
 AAATACAAGATGAACCTGTACGGCTTCCACGGTGGCCAGCGCGTAGGCCCTGTGTCTGCC       c.9420
 K  Y  K  M  N  L  Y  G  F  H  G  G  Q  R  V  G  P  V  S  A         p.3140

          .    | 28    .         .         .         .         .    g.64834
 ATTGGGGTGACGG | AGGAAGAGACCCCCAGCCCCACAGAACCCAGCACTGAGGCCCCGGAG    c.9480
 I  G  V  T  E |   E  E  T  P  S  P  T  E  P  S  T  E  A  P  E      p.3160

          .         .         .         .         .         .       g.64894
 GCCCCTGAGGAGCCGCTCCTGGGGGAGTTGACAGTGACAGGATCCTCCCCTGACTCGCTG       c.9540
 A  P  E  E  P  L  L  G  E  L  T  V  T  G  S  S  P  D  S  L         p.3180

          .         .         .         .         .         .       g.64954
 AGCCTCTCCTGGACCGTCCCCCAGGGCCGCTTCGACTCCTTCACCGTGCAGTACAAGGAC       c.9600
 S  L  S  W  T  V  P  Q  G  R  F  D  S  F  T  V  Q  Y  K  D         p.3200

          .         .         .         .         .         .       g.65014
 AGGGACGGGCAGCCCCAGGTGGTGCGTGTCAGGGGCGAGGAGAGCGAGGTCACCGTGGGG       c.9660
 R  D  G  Q  P  Q  V  V  R  V  R  G  E  E  S  E  V  T  V  G         p.3220

          .         .         .         .         .         .       g.65074
 GGCCTGGAGCCCGGGCGCAAATACAAGATGCATCTGTACGGCCTCCACGAGGGGCAGCGC       c.9720
 G  L  E  P  G  R  K  Y  K  M  H  L  Y  G  L  H  E  G  Q  R         p.3240

          .         .         .  | 29      .         .         .    g.65753
 GTGGGCCCAGTGTCCACCGTGGGCATCACGG | CGCCCCTGCCCACACCACTGCCGGTGGAG    c.9780
 V  G  P  V  S  T  V  G  I  T  A |   P  L  P  T  P  L  P  V  E      p.3260

          .         .         .         .         .         .       g.65813
 CCCCGCCTGGGGGAGCTGGCGGTGGCGGCCGTGACCTCGGACTCAGTGGGCCTCTCATGG       c.9840
 P  R  L  G  E  L  A  V  A  A  V  T  S  D  S  V  G  L  S  W         p.3280

          .         .         .         .         .         .       g.65873
 ACGGTGGCCCAGGGCCCCTTTGACTCCTTCCTGGTACAGTACAGGGACGCGCAGGGGCAG       c.9900
 T  V  A  Q  G  P  F  D  S  F  L  V  Q  Y  R  D  A  Q  G  Q         p.3300

          .         .         .         .         .         .       g.65933
 CCCCAGGCAGTGCCTGTGAGCGGAGACCTCCGAGCGGTCGCCGTCTCGGGGCTGGACCCG       c.9960
 P  Q  A  V  P  V  S  G  D  L  R  A  V  A  V  S  G  L  D  P         p.3320

          .         .         .         .         .         .       g.65993
 GCCCGCAAGTACAAGTTCCTGCTCTTTGGACTCCAGAATGGGAAACGCCACGGCCCAGTC       c.10020
 A  R  K  Y  K  F  L  L  F  G  L  Q  N  G  K  R  H  G  P  V         p.3340

          .          | 30        .         .         .         .    g.66403
 CCTGTGGAGGCCAGGACCG | CCCCAGACACCAAACCGTCTCCCCGCCTGGGGGAGCTGACT    c.10080
 P  V  E  A  R  T  A |   P  D  T  K  P  S  P  R  L  G  E  L  T      p.3360

          .         .         .         .         .         .       g.66463
 GTGACAGATGCGACCCCTGACTCCGTGGGCCTCTCGTGGACGGTCCCTGAGGGCGAATTC       c.10140
 V  T  D  A  T  P  D  S  V  G  L  S  W  T  V  P  E  G  E  F         p.3380

          .         .         .         .         .         .       g.66523
 GACTCCTTCGTGGTCCAGTACAAGGATAAGGATGGTCGGCTCCAGGTGGTGCCGGTGGCA       c.10200
 D  S  F  V  V  Q  Y  K  D  K  D  G  R  L  Q  V  V  P  V  A         p.3400

          .         .         .         .         .         .       g.66583
 GCCAACCAGCGGGAGGTCACAGTCCAGGGCCTGGAGCCCAGTAGGAAATACAGGTTCCTG       c.10260
 A  N  Q  R  E  V  T  V  Q  G  L  E  P  S  R  K  Y  R  F  L         p.3420

          .         .         .         .         .         | 31    g.67920
 CTCTATGGTCTGTCAGGCAGGAAACGACTGGGCCCCATCTCTGCTGACAGCACCACAG | CT    c.10320
 L  Y  G  L  S  G  R  K  R  L  G  P  I  S  A  D  S  T  T  A |       p.3440

          .         .         .         .         .         .       g.67980
 CCCCTGGAGAAGGAGCTACCTCCCCACCTGGGGGAACTGACCGTGGCTGAGGAGACCTCC       c.10380
 P  L  E  K  E  L  P  P  H  L  G  E  L  T  V  A  E  E  T  S         p.3460

          .         .         .         .         .         .       g.68040
 AGCTCTCTGCGCCTGTCCTGGACGGTAGCCCAGGGCCCCTTTGACTCCTTCGTGGTCCAG       c.10440
 S  S  L  R  L  S  W  T  V  A  Q  G  P  F  D  S  F  V  V  Q         p.3480

          .         .         .         .         .         .       g.68100
 TACAGGGACACGGACGGGCAGCCCAGGGCAGTGCCTGTGGCCGCAGACCAGCGCACAGTC       c.10500
 Y  R  D  T  D  G  Q  P  R  A  V  P  V  A  A  D  Q  R  T  V         p.3500

          .         .         .         .         .         .       g.68160
 ACCGTAGAGGACCTGGAGCCTGGCAAGAAATACAAGTTTCTGCTCTACGGGCTCCTTGGG       c.10560
 T  V  E  D  L  E  P  G  K  K  Y  K  F  L  L  Y  G  L  L  G         p.3520

          .         .         .         . | 32       .         .    g.69068
 GGAAAGCGCCTGGGCCCGGTCTCTGCCCTGGGAATGACAG | CCCCAGAAGAGGACACACCA    c.10620
 G  K  R  L  G  P  V  S  A  L  G  M  T  A |   P  E  E  D  T  P      p.3540

          .         .         .         .         .         .       g.69128
 GCCCCAGAGTTAGCCCCAGAGGCCCCTGAGCCTCCTGAAGAGCCCCGCCTAGGAGTGCTG       c.10680
 A  P  E  L  A  P  E  A  P  E  P  P  E  E  P  R  L  G  V  L         p.3560

          .         .         .         .         .         .       g.69188
 ACCGTGACCGACACAACCCCAGACTCCATGCGCCTCTCGTGGAGCGTGGCCCAGGGCCCC       c.10740
 T  V  T  D  T  T  P  D  S  M  R  L  S  W  S  V  A  Q  G  P         p.3580

          .         .         .         .         .         .       g.69248
 TTTGATTCCTTCGTGGTCCAGTATGAGGACACGAACGGGCAGCCCCAGGCCTTGCTCGTG       c.10800
 F  D  S  F  V  V  Q  Y  E  D  T  N  G  Q  P  Q  A  L  L  V         p.3600

          .         .         .         .         .         .       g.69308
 GACGGCGACCAGAGCAAGATCCTCATCTCAGGCCTGGAGCCCAGCACCCCCTACAGGTTC       c.10860
 D  G  D  Q  S  K  I  L  I  S  G  L  E  P  S  T  P  Y  R  F         p.3620

          .         .         .         .         .         .       g.69368
 CTCCTCTATGGCCTCCATGAAGGGAAGCGCCTGGGGCCCCTCTCAGCTGAGGGCACCACA       c.10920
 L  L  Y  G  L  H  E  G  K  R  L  G  P  L  S  A  E  G  T  T         p.3640

   | 33      .         .         .         .         .         .    g.69717
 G | GGCTGGCTCCTGCTGGTCAGACCTCAGAGGAGTCAAGGCCCCGCCTGTCCCAGCTGTCT    c.10980
 G |   L  A  P  A  G  Q  T  S  E  E  S  R  P  R  L  S  Q  L  S      p.3660

          .         .         .         .         .         .       g.69777
 GTGACTGACGTGACCACCAGTTCACTGAGGCTCAACTGGGAGGCCCCACCGGGGGCCTTC       c.11040
 V  T  D  V  T  T  S  S  L  R  L  N  W  E  A  P  P  G  A  F         p.3680

          .         .         .         .         .         .       g.69837
 GACTCCTTCCTGCTCCGCTTTGGGGTTCCATCACCAAGCACTCTGGAGCCGCATCCGCGT       c.11100
 D  S  F  L  L  R  F  G  V  P  S  P  S  T  L  E  P  H  P  R         p.3700

          .         .         .         .         .         .       g.69897
 CCACTGCTGCAGCGCGAGCTGATGGTGCCGGGGACGCGGCACTCGGCCGTGCTCCGGGAC       c.11160
 P  L  L  Q  R  E  L  M  V  P  G  T  R  H  S  A  V  L  R  D         p.3720

          .         .         .         .         .         .       g.69957
 CTGCGTTCCGGGACTCTGTACAGCCTGACACTGTATGGGCTGCGAGGACCCCACAAGGCC       c.11220
 L  R  S  G  T  L  Y  S  L  T  L  Y  G  L  R  G  P  H  K  A         p.3740

          .         .         .        | 34.         .         .    g.70268
 GACAGCATCCAGGGAACCGCCCGCACCCTCAGCCCAG | TTCTGGAGAGCCCCCGTGACCTC    c.11280
 D  S  I  Q  G  T  A  R  T  L  S  P  V |   L  E  S  P  R  D  L      p.3760

          .         .         .         .         .         .       g.70328
 CAATTCAGTGAAATCAGGGAGACCTCAGCCAAGGTCAACTGGATGCCCCCACCATCCCGG       c.11340
 Q  F  S  E  I  R  E  T  S  A  K  V  N  W  M  P  P  P  S  R         p.3780

          .         .         .         . | 35       .         .    g.70502
 GCGGACAGCTTCAAAGTCTCCTACCAGCTGGCGGACGGAG | GGGAGCCTCAGAGTGTGCAG    c.11400
 A  D  S  F  K  V  S  Y  Q  L  A  D  G  G |   E  P  Q  S  V  Q      p.3800

          .         .         .         .         .         .       g.70562
 GTGGATGGCCAGGCCCGGACCCAGAAACTCCAGGGGCTGATCCCAGGCGCTCGCTATGAG       c.11460
 V  D  G  Q  A  R  T  Q  K  L  Q  G  L  I  P  G  A  R  Y  E         p.3820

          .         .         .         .         .         .       g.70622
 GTGACCGTGGTCTCGGTCCGAGGCTTTGAGGAGAGTGAGCCTCTCACAGGCTTCCTCACC       c.11520
 V  T  V  V  S  V  R  G  F  E  E  S  E  P  L  T  G  F  L  T         p.3840

      | 36   .         .         .         .         .         .    g.70874
 ACGG | TTCCTGACGGTCCCACACAGTTGCGTGCACTGAACTTGACCGAGGGATTCGCCGTG    c.11580
 T  V |   P  D  G  P  T  Q  L  R  A  L  N  L  T  E  G  F  A  V      p.3860

          .         .         .         .         .         .       g.70934
 CTGCACTGGAAGCCCCCCCAGAATCCTGTGGACACCTATGACGTCCAGGTCACAGCCCCT       c.11640
 L  H  W  K  P  P  Q  N  P  V  D  T  Y  D  V  Q  V  T  A  P         p.3880

      | 37   .         .         .         .         .         .    g.71112
 GGGG | CCCCGCCTCTGCAGGCGGAGACCCCAGGCAGCGCGGTGGACTACCCCCTGCATGAC    c.11700
 G  A |   P  P  L  Q  A  E  T  P  G  S  A  V  D  Y  P  L  H  D      p.3900

          .         .         .         .         .         .       g.71172
 CTTGTCCTCCACACCAACTACACCGCCACAGTGCGTGGCCTGCGGGGCCCCAACCTCACT       c.11760
 L  V  L  H  T  N  Y  T  A  T  V  R  G  L  R  G  P  N  L  T         p.3920

          .         .         | 38         .         .         .    g.71325
 TCCCCAGCCAGCATCACCTTCACCACAG | GGCTAGAGGCCCCTCGGGACTTGGAGGCCAAG    c.11820
 S  P  A  S  I  T  F  T  T  G |   L  E  A  P  R  D  L  E  A  K      p.3940

          .         .         .         .         .         .       g.71385
 GAAGTGACCCCCCGCACCGCCCTGCTCACTTGGACTGAGCCCCCAGTCCGGCCCGCAGGC       c.11880
 E  V  T  P  R  T  A  L  L  T  W  T  E  P  P  V  R  P  A  G         p.3960

          .         .         .          | 39        .         .    g.71564
 TACCTGCTCAGCTTCCACACCCCTGGTGGACAGAACCAG | GAGATCCTGCTCCCAGGAGGG    c.11940
 Y  L  L  S  F  H  T  P  G  G  Q  N  Q   | E  I  L  L  P  G  G      p.3980

          .         .         .         .         .         .       g.71624
 ATCACATCTCACCAGCTCCTTGGCCTCTTTCCCTCCACCTCCTACAATGCACGGCTCCAG       c.12000
 I  T  S  H  Q  L  L  G  L  F  P  S  T  S  Y  N  A  R  L  Q         p.4000

          .         .         .         .         .   | 40     .    g.71776
 GCCATGTGGGGCCAGAGCCTCCTGCCGCCCGTGTCCACCTCTTTCACCACGG | GTGGGCTG    c.12060
 A  M  W  G  Q  S  L  L  P  P  V  S  T  S  F  T  T  G |   G  L      p.4020

          .         .         .         .         .         .       g.71836
 CGGATCCCCTTCCCCAGGGACTGCGGGGAGGAGATGCAGAACGGAGCCGGTGCCTCCAGG       c.12120
 R  I  P  F  P  R  D  C  G  E  E  M  Q  N  G  A  G  A  S  R         p.4040

          .         .         .         .         .         .       g.71896
 ACCAGCACCATCTTCCTCAACGGCAACCGCGAGCGGCCCCTGAACGTGTTTTGCGACATG       c.12180
 T  S  T  I  F  L  N  G  N  R  E  R  P  L  N  V  F  C  D  M         p.4060

          .         .     | 41   .         .         .         .    g.72048
 GAGACTGATGGGGGCGGCTGGCTG | GTGTTCCAGCGCCGCATGGATGGACAGACAGACTTC    c.12240
 E  T  D  G  G  G  W  L   | V  F  Q  R  R  M  D  G  Q  T  D  F      p.4080

          .         .         .         .         .         .       g.72108
 TGGAGGGACTGGGAGGACTATGCCCATGGTTTTGGGAACATCTCTGGAGAGTTCTGGCTG       c.12300
 W  R  D  W  E  D  Y  A  H  G  F  G  N  I  S  G  E  F  W  L         p.4100

   | 42      .         .         .         .         .         .    g.72260
 G | GCAATGAGGCCCTGCACAGCCTGACACAGGCAGGTGACTACTCCATGCGCGTGGACCTG    c.12360
 G |   N  E  A  L  H  S  L  T  Q  A  G  D  Y  S  M  R  V  D  L      p.4120

          .         .         .         .         .         .       g.72320
 CGGGCTGGGGACGAGGCTGTGTTCGCCCAGTACGACTCCTTCCACGTAGACTCGGCTGCG       c.12420
 R  A  G  D  E  A  V  F  A  Q  Y  D  S  F  H  V  D  S  A  A         p.4140

          .         .         .         .    | 43    .         .    g.72457
 GAGTACTACCGCCTCCACTTGGAGGGCTACCACGGCACCGCAG | GGGACTCCATGAGCTAC    c.12480
 E  Y  Y  R  L  H  L  E  G  Y  H  G  T  A  G |   D  S  M  S  Y      p.4160

          .         .         .         .         .         .       g.72517
 CACAGCGGCAGTGTCTTCTCTGCCCGTGATCGGGACCCCAACAGCTTGCTCATCTCCTGC       c.12540
 H  S  G  S  V  F  S  A  R  D  R  D  P  N  S  L  L  I  S  C         p.4180

          .         .         .         .         .         .       g.72577
 GCTGTCTCCTACCGAGGGGCCTGGTGGTACAGGAACTGCCACTACGCCAACCTCAACGGG       c.12600
 A  V  S  Y  R  G  A  W  W  Y  R  N  C  H  Y  A  N  L  N  G         p.4200

          .         .        | 44.         .         .         .    g.72957
 CTCTACGGGAGCACAGTGGACCATCAG | GGAGTGAGCTGGTACCACTGGAAGGGCTTCGAG    c.12660
 L  Y  G  S  T  V  D  H  Q   | G  V  S  W  Y  H  W  K  G  F  E      p.4220

          .         .         .         .         .         .       g.73017
 TTCTCGGTGCCCTTCACGGAAATGAAGCTGAGACCAAGAAACTTTCGCTCCCCAGCGGGG       c.12720
 F  S  V  P  F  T  E  M  K  L  R  P  R  N  F  R  S  P  A  G         p.4240

                                                                    g.73026
 GGAGGCTGA                                                          c.12729
 G  G  X                                                            p.4242

          .         .         .         .         .         .       g.73086
 gctgctgcccacctctctcgcaccccagtatgactgccgagcactgaggggtcgccccga       c.*60

          .         .         .         .         .         .       g.73146
 gagaagagccagggtccttcaccacccagccgctggaggaagccttctctgccagcgatc       c.*120

          .         .         .         .         .         .       g.73206
 tcgcagcactgtgtttacaggggggaggggaggggttcgtacgggagcaataaaggagaa       c.*180

          .                                                         g.73220
 actgaggtacccgg                                                     c.*194

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Tenascin XB protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2013 Leiden University Medical Center